Orthologous regulated operons containing mtsB gene
Regulog: | MntR - Corynebacteriaceae |
Regulator type: | Transcription factor |
Regulator family: | DtxR |
Regulation mode: | repressor |
Biological process: | Manganese homeostasis |
Effector: | Manganese ion, (Mn2+) |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Corynebacterium jeikeium K411 | ||||
Position: -57
Score: 6.35707 Sequence: TTGTTCAATACATTGAACAT
Position: -18
Score: 4.57856 Sequence: AGGTTTATTACCTTGAAAAT
Locus tag: jk1486
Name: mtsA Funciton: Manganese ABC transporter, substrate-binding protein
Locus tag: jk1487
Name: mtsB Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: jk1488
Name: mtsC Funciton: Manganese ABC transporter, permease protein |
||||
mtsA-mtsB-mtsC | -57 | 6.4 | TTGTTCAATACATTGAACAT | jk1486 |
-18 | 4.6 | AGGTTTATTACCTTGAAAAT | ||
Corynebacterium kroppenstedtii DSM 44385 | ||||
Position: -177
Score: 5.90017 Sequence: AAATACATTGCATTGAACTT
Locus tag: ckrop_1572
Name: mtsA Funciton: Manganese ABC transporter, substrate-binding protein
Locus tag: ckrop_1573
Name: mtsB Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: ckrop_1574
Name: mtsC Funciton: Manganese ABC transporter, permease protein |
||||
mtsA-mtsB-mtsC | -177 | 5.9 | AAATACATTGCATTGAACTT | ckrop_1572 |
Corynebacterium urealyticum DSM 7109 | ||||
Position: -56
Score: 6.63223 Sequence: AAGTTCAATACATTGAACTT
Locus tag: cur_0526
Name: mtsB Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: cur_0525
Name: mtsCA Funciton: Manganese ABC transporter, permease and substrate-binding protein |
||||
mtsB-mtsCA | -56 | 6.6 | AAGTTCAATACATTGAACTT | cur_0526 |