Orthologous regulated operons containing mntO gene
Regulog: | MntR - Corynebacteriaceae |
Regulator type: | Transcription factor |
Regulator family: | DtxR |
Regulation mode: | repressor |
Biological process: | Manganese homeostasis |
Effector: | Manganese ion, (Mn2+) |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Corynebacterium aurimucosum ATCC 700975 | ||||
Position: -51
Score: 6.66413 Sequence: AAGTTCAATCCATTGAACAT
Locus tag: cauri_0334
Name: mntM Funciton: Manganese ABC transporter, substrate-binding protein
Locus tag: cauri_0333
Name: mntN Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: cauri_0332
Name: mntO Funciton: Manganese ABC transporter, permease protein 2
Locus tag: cauri_0331
Name: mntQ Funciton: Manganese ABC transporter, permease protein 2 |
||||
mntM-mntN-mntO-mntQ | -51 | 6.7 | AAGTTCAATCCATTGAACAT | cauri_0334 |