Orthologous regulated operons containing mntM gene
| Regulog: | MntR - Corynebacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Corynebacterium aurimucosum ATCC 700975 | ||||
|
Position: -51
Score: 6.66413 Sequence: AAGTTCAATCCATTGAACAT
Locus tag: cauri_0334
Name: mntM Funciton: Manganese ABC transporter, substrate-binding protein
Locus tag: cauri_0333
Name: mntN Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: cauri_0332
Name: mntO Funciton: Manganese ABC transporter, permease protein 2
Locus tag: cauri_0331
Name: mntQ Funciton: Manganese ABC transporter, permease protein 2 |
||||
| mntM-mntN-mntO-mntQ | -51 | 6.7 | AAGTTCAATCCATTGAACAT | cauri_0334 |