Orthologous regulated operons containing mtsCA gene
| Regulog: | MntR - Corynebacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Corynebacterium urealyticum DSM 7109 | ||||
|
Position: -56
Score: 6.63223 Sequence: AAGTTCAATACATTGAACTT
Locus tag: cur_0526
Name: mtsB Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: cur_0525
Name: mtsCA Funciton: Manganese ABC transporter, permease and substrate-binding protein |
||||
| mtsB-mtsCA | -56 | 6.6 | AAGTTCAATACATTGAACTT | cur_0526 |