Orthologous regulated operons containing mntT gene
| Regulog: | MntR - Corynebacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Corynebacterium efficiens YS-314 | ||||
|
Position: -34
Score: 6.03261 Sequence: ATGTTCATGCCATTGAACAT
Locus tag: CE1566
Name: mntT Funciton: Predicted manganese transporter |
||||
| mntT | -34 | 6 | ATGTTCATGCCATTGAACAT | CE1566 |
| Corynebacterium glutamicum ATCC 13032 | ||||
|
Position: -34
Score: 6.30795 Sequence: CTGTTCAATGCGTTGAACAT
Locus tag: cg1623
Name: mntT Funciton: Predicted manganese transporter |
||||
| mntT | -34 | 6.3 | CTGTTCAATGCGTTGAACAT | cg1623 |