Orthologous regulated operons containing nrdF2 gene
Regulog: | MntR - Corynebacteriaceae |
Regulator type: | Transcription factor |
Regulator family: | DtxR |
Regulation mode: | repressor |
Biological process: | Manganese homeostasis |
Effector: | Manganese ion, (Mn2+) |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Corynebacterium diphtheriae NCTC 13129 | ||||
Position: -81
Score: 6.7456 Sequence: AAGTTCAATGCATTGAACTT
Locus tag: DIP1923
Name: nrdI2 Funciton: Ribonucleotide reduction protein NrdI
Locus tag: DIP1924
Name: nrdF2 Funciton: Ribonucleoside-diphosphate reductase, beta subunit |
||||
nrdI2-nrdF2 | -81 | 6.7 | AAGTTCAATGCATTGAACTT | DIP1923 |
Corynebacterium jeikeium K411 | ||||
Position: -123
Score: 5.16116 Sequence: AAGTTCAATACATTGTTGTT
Position: -100
Score: 4.80419 Sequence: AAGTTCGGGTCATTGAACTT
Locus tag: jk0226
Name: nrdI2 Funciton: Ribonucleotide reduction protein NrdI
Locus tag: jk0225
Name: nrdF2 Funciton: Ribonucleoside-diphosphate reductase, beta subunit |
||||
nrdI2-nrdF2 | -123 | 5.2 | AAGTTCAATACATTGTTGTT | jk0226 |
-100 | 4.8 | AAGTTCGGGTCATTGAACTT | ||
Corynebacterium kroppenstedtii DSM 44385 | ||||
Position: -72
Score: 5.63145 Sequence: AAGTTCAAGCCATTGAATAA
Locus tag: ckrop_3000
Name: nrdI2 Funciton: Ribonucleotide reduction protein NrdI
Locus tag: ckrop_0016
Name: nrdF2 Funciton: Ribonucleoside-diphosphate reductase, beta subunit |
||||
nrdI2-nrdF2 | -72 | 5.6 | AAGTTCAAGCCATTGAATAA | ckrop_3000 |