Orthologous regulated operons containing mntR gene

Properties
Regulog:	MntR - Corynebacteriaceae
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Phylum:	Actinobacteria

Built upon 16 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Corynebacterium amycolatum SK46
Position: -153 Score: 6.11441 Sequence: AAGTTCAATGGGTTGAAAAT Locus tag: CORAM0001_0534 Name: mntA Funciton: Manganese ABC transporter, substrate-binding protein Locus tag: CORAM0001_0535 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: CORAM0001_0536 Name: mntC Funciton: Manganese ABC transporter, permease protein 1 Locus tag: CORAM0001_0537 Name: mntD Funciton: Manganese ABC transporter, permease protein 2 Locus tag: CORAM0001_0538 Name: mntR Funciton: Mn-dependent transcriptional regulator MntR, DtxR family
mntA-mntB-mntC-mntD-mntR	-153	6.1	AAGTTCAATGGGTTGAAAAT	CORAM0001_0534
Corynebacterium aurimucosum ATCC 700975
Position: -76 Score: 6.49088 Sequence: ATGTTCAATGGATTGAACTT Locus tag: cauri_0335 Name: mntR Funciton: Mn-dependent transcriptional regulator MntR, DtxR family
mntR	-76	6.5	ATGTTCAATGGATTGAACTT	cauri_0335
Corynebacterium diphtheriae NCTC 13129
Position: -91 Score: 5.64255 Sequence: AAATTCAATACGCTGAACAG Locus tag: DIP0615 Name: mntA Funciton: Manganese ABC transporter, substrate-binding protein Locus tag: DIP0616 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: DIP0617 Name: mntC Funciton: Manganese ABC transporter, permease protein 1 Locus tag: DIP0618 Name: mntD Funciton: Manganese ABC transporter, permease protein 2 Locus tag: DIP0619 Name: mntR Funciton: Mn-dependent transcriptional regulator MntR, DtxR family
mntA-mntB-mntC-mntD-mntR	-91	5.6	AAATTCAATACGCTGAACAG	DIP0615
Corynebacterium jeikeium K411
Position: -86 Score: 6.15268 Sequence: ATGTTCAATGTATTGAACAA Locus tag: jk1485 Name: mntR Funciton: Mn-dependent transcriptional regulator MntR, DtxR family
mntR	-86	6.2	ATGTTCAATGTATTGAACAA	jk1485
Corynebacterium kroppenstedtii DSM 44385
Position: -143 Score: 5.71292 Sequence: AAGTTCAATGCAATGTATTT Locus tag: ckrop_1571 Name: mntR Funciton: Mn-dependent transcriptional regulator MntR, DtxR family
mntR	-143	5.7	AAGTTCAATGCAATGTATTT	ckrop_1571