Orthologous regulated operons containing mntA gene
Regulog: | MntR - Corynebacteriaceae |
Regulator type: | Transcription factor |
Regulator family: | DtxR |
Regulation mode: | repressor |
Biological process: | Manganese homeostasis |
Effector: | Manganese ion, (Mn2+) |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Corynebacterium amycolatum SK46 | ||||
Position: -153
Score: 6.11441 Sequence: AAGTTCAATGGGTTGAAAAT
Locus tag: CORAM0001_0534
Name: mntA Funciton: Manganese ABC transporter, substrate-binding protein
Locus tag: CORAM0001_0535
Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: CORAM0001_0536
Name: mntC Funciton: Manganese ABC transporter, permease protein 1
Locus tag: CORAM0001_0537
Name: mntD Funciton: Manganese ABC transporter, permease protein 2
Locus tag: CORAM0001_0538
Name: mntR Funciton: Mn-dependent transcriptional regulator MntR, DtxR family |
||||
mntA-mntB-mntC-mntD-mntR | -153 | 6.1 | AAGTTCAATGGGTTGAAAAT | CORAM0001_0534 |
Corynebacterium diphtheriae NCTC 13129 | ||||
Position: -91
Score: 5.64255 Sequence: AAATTCAATACGCTGAACAG
Locus tag: DIP0615
Name: mntA Funciton: Manganese ABC transporter, substrate-binding protein
Locus tag: DIP0616
Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: DIP0617
Name: mntC Funciton: Manganese ABC transporter, permease protein 1
Locus tag: DIP0618
Name: mntD Funciton: Manganese ABC transporter, permease protein 2
Locus tag: DIP0619
Name: mntR Funciton: Mn-dependent transcriptional regulator MntR, DtxR family |
||||
mntA-mntB-mntC-mntD-mntR | -91 | 5.6 | AAATTCAATACGCTGAACAG | DIP0615 |