Orthologous regulated operons containing COG3748 gene

Properties
Regulog:	RutR - Alteromonadales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Phylum:	Proteobacteria/gamma

Built upon 19 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Alteromonadales bacterium TW-7
Position: -328 Score: 5.08432 Sequence: ACATATCCTTTTGGTCAGGT Position: -148 Score: 4.9395 Sequence: AGTTAACCGATCGGTCAGGC Locus tag: ATW7_02017 Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) Locus tag: ATW7_02012 Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) Locus tag: ATW7_02007 Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) Locus tag: ATW7_02002 Name: pucL Funciton: Uricase (EC 1.7.3.3) Locus tag: ATW7_01997 Name: pucM Funciton: Hydroxyisourate hydrolase (EC 3.5.2.17) Locus tag: ATW7_01992 Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3) Locus tag: ATW7_01987 Name: COG3748 Funciton: hypothetical protein, COG3748 Locus tag: ATW7_01982 Name: COG0726 Funciton: putative polysaccharide deacetylase family protein
xdhA-xdhB-xdhC-pucL-pucM-guaD-COG3748-COG0726	-328	5.1	ACATATCCTTTTGGTCAGGT	ATW7_02017
	-148	4.9	AGTTAACCGATCGGTCAGGC
Alteromonas macleodii 'Deep ecotype'
Position: -83 Score: 5.76872 Sequence: AATTGACCATTTGGTCTACT Locus tag: MADE_02515 Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) Locus tag: MADE_02516 Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) Locus tag: MADE_02517 Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) Locus tag: MADE_02518 Name: pucL Funciton: Uricase (EC 1.7.3.3) Locus tag: MADE_02519 Name: pucM Funciton: Hydroxyisourate hydrolase (EC 3.5.2.17) Locus tag: MADE_02520 Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3) Locus tag: MADE_02521 Name: COG3748 Funciton: hypothetical protein, COG3748
xdhA-xdhB-xdhC-pucL-pucM-guaD-COG3748	-83	5.8	AATTGACCATTTGGTCTACT	MADE_02515
Pseudoalteromonas atlantica T6c
Position: -91 Score: 5.69836 Sequence: ACCTGACCAACTGGTCTGGT Locus tag: Patl_2424 Name: xdhA Funciton: Xanthine dehydrogenase, iron-sulfur cluster and FAD-binding subunit A (1.17.1.4) Locus tag: Patl_2425 Name: xdhB Funciton: Xanthine dehydrogenase, molybdenum binding subunit (EC 1.17.1.4) Locus tag: Patl_2426 Name: xdhC Funciton: XdhC protein (assists in molybdopterin insertion into xanthine dehydrogenase) Locus tag: Patl_2427 Name: pucL Funciton: Uricase (EC 1.7.3.3) Locus tag: Patl_2428 Name: pucM Funciton: Hydroxyisourate hydrolase (EC 3.5.2.17) Locus tag: Patl_2429 Name: guaD Funciton: Guanine deaminase (EC 3.5.4.3) Locus tag: Patl_2430 Name: COG3748 Funciton: hypothetical protein, COG3748
xdhA-xdhB-xdhC-pucL-pucM-guaD-COG3748	-91	5.7	ACCTGACCAACTGGTCTGGT	Patl_2424