Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing OB2597_05560 gene

Properties
Regulog: PhnF - Rhodobacterales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization
Effector:
Phylum: Proteobacteria
Built upon 23 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Oceanicola batsensis HTCC2597
Position: -37
Score: 5.93846
Sequence: TTGTATAGGTAAATAGACAA
Locus tag: OB2597_05575
Name: phnG
Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
Locus tag: OB2597_05570
Name: phnH
Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnH
Locus tag: OB2597_05565
Name: phnI
Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnI
Locus tag: OB2597_05560
Name: null
Funciton: hypothetical protein
Locus tag: OB2597_05555
Name: phnJ
Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnJ
Locus tag: OB2597_05550
Name: phnK
Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnK
Locus tag: OB2597_05545
Name: phnL
Funciton: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnL
Locus tag: OB2597_05540
Name: phnN
Funciton: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
Locus tag: OB2597_05535
Name: phnM
Funciton: Alpha-D-ribose-1-methylphosphonate-5-triphosphate hydrolase
phnG-phnH-phnI-OB2597_05560-phnJ-phnK-phnL-phnN-phnM -37 5.9 TTGTATAGGTAAATAGACAA OB2597_05575
© 2009-2020 RegPrecise