Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing PF11086 gene

Properties
Regulog: PhrR - Vibrionales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: repressor
Biological process: Light-dependent DNA repair
Effector: Heat shock; Adenosylcobalamin
Phylum: Proteobacteria/Gamma
Built upon 16 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Vibrio angustum S14
Position: -87
Score: 6.15881
Sequence: TATACAATAAAAAAACTTGTACA
Locus tag: VAS14_11844
Name: COG3272
Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
Locus tag: VAS14_11849
Name: VAS14_11849
Funciton: hypothetical protein
Locus tag: VAS14_11854
Name: COG3272
Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
Locus tag: VAS14_11859
Name: metY
Funciton: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48)
Locus tag: VAS14_11864
Name: phrR
Funciton: Transcriptional regulator, MerR family, associated with photolyase
Locus tag: VAS14_11869
Name: phr
Funciton: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
Locus tag: VAS14_11874
Name: PF07366
Funciton: Protein of unknown function DUF1486
Locus tag: VAS14_11879
Name: PF00106
Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Locus tag: VAS14_11884
Name: PF01593
Funciton: Flavin containing amine oxidoreductase
Locus tag: VAS14_11889
Name: PF07103
Funciton: Protein of unknown function DUF1365
Locus tag: VAS14_11894
Name: PF02353
Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
Locus tag: VAS14_11899
Name: PF11086
Funciton: Protein of unknown function DUF2878
COG3272-VAS14_11849-COG3272-metY-phrR-phr-PF07366-PF00106-PF01593-PF07103-PF02353-PF11086 -87 6.2 TATACAATAAAAAAACTTGTACA VAS14_11844
Vibrio cholerae O1 biovar eltor str. N16961
Position: -32
Score: 5.57279
Sequence: TATACGAATCTTAAATTTGTATA
Locus tag: VC1118
Name: PF07366
Funciton: Protein of unknown function DUF1486
Locus tag: VC1119
Name: PF00106
Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Locus tag: VC1120
Name: PF01593
Funciton: Flavin containing amine oxidoreductase
Locus tag: VC1121
Name: PF07103
Funciton: Protein of unknown function DUF1365
Locus tag: VC1122
Name: PF02353
Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
Locus tag: VC1123
Name: PF11086
Funciton: Protein of unknown function DUF2878
Locus tag: VC1124
Name: FIG026291
Funciton: FIG026291: Hypothetical periplasmic protein
Locus tag: VC1125
Name: FIG002577
Funciton: FIG002577: Putative lipoprotein precursor
PF07366-PF00106-PF01593-PF07103-PF02353-PF11086-FIG026291-FIG002577 -32 5.6 TATACGAATCTTAAATTTGTATA VC1118
Vibrio harveyi ATCC BAA-1116
Position: -51
Score: 6.47882
Sequence: TGTACATATAATATTTTTGTACA
Locus tag: VIBHAR_01814
Name: PF07366
Funciton: Protein of unknown function DUF1486
Locus tag: VIBHAR_01815
Name: PF00106
Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Locus tag: VIBHAR_01816
Name: PF01593
Funciton: Flavin containing amine oxidoreductase
Locus tag: VIBHAR_01817
Name: PF07103
Funciton: Protein of unknown function DUF1365
Locus tag: VIBHAR_01818
Name: PF02353
Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
Locus tag: VIBHAR_01819
Name: PF11086
Funciton: Protein of unknown function DUF2878
Locus tag: VIBHAR_01820
Name: FIG026291
Funciton: FIG026291: Hypothetical periplasmic protein
Locus tag: VIBHAR_01821
Name: FIG002577
Funciton: FIG002577: Putative lipoprotein precursor
PF07366-PF00106-PF01593-PF07103-PF02353-PF11086-FIG026291-FIG002577 -51 6.5 TGTACATATAATATTTTTGTACA VIBHAR_01814
Vibrio parahaemolyticus RIMD 2210633
Position: -96
Score: 6.41387
Sequence: TATACAAGTTTTTTTTTTGTACA
Position: -51
Score: 6.33457
Sequence: TGTACATGTAATATTTTTGTACA
Locus tag: VP1119
Name: PF07366
Funciton: Protein of unknown function DUF1486
Locus tag: VP1120
Name: PF00106
Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Locus tag: VP1121
Name: PF01593
Funciton: Flavin containing amine oxidoreductase
Locus tag: VP1122
Name: PF07103
Funciton: Protein of unknown function DUF1365
Locus tag: VP1123
Name: PF02353
Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
Locus tag: VP1124
Name: PF11086
Funciton: Protein of unknown function DUF2878
Locus tag: VP1125
Name: FIG026291
Funciton: FIG026291: Hypothetical periplasmic protein
Locus tag: VP1126
Name: FIG002577
Funciton: FIG002577: Putative lipoprotein precursor
PF07366-PF00106-PF01593-PF07103-PF02353-PF11086-FIG026291-FIG002577 -96 6.4 TATACAAGTTTTTTTTTTGTACA VP1119
-51 6.3 TGTACATGTAATATTTTTGTACA
Vibrio shilonii AK1
Position: -95
Score: 4.60909
Sequence: TATACAAAAAGTTGTACTTTCCA
Locus tag: VSAK1_00115
Name: PF07366
Funciton: Protein of unknown function DUF1486
Locus tag: VSAK1_00120
Name: PF00106
Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Locus tag: VSAK1_00125
Name: PF01593
Funciton: Flavin containing amine oxidoreductase
Locus tag: VSAK1_00130
Name: PF07103
Funciton: Protein of unknown function DUF1365
Locus tag: VSAK1_00135
Name: PF02353
Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
Locus tag: VSAK1_00140
Name: PF11086
Funciton: Protein of unknown function DUF2878
Locus tag: VSAK1_00145
Name: FIG026291
Funciton: FIG026291: Hypothetical periplasmic protein
Locus tag: VSAK1_00150
Name: FIG002577
Funciton: FIG002577: Putative lipoprotein precursor
PF07366-PF00106-PF01593-PF07103-PF02353-PF11086-FIG026291-FIG002577 -95 4.6 TATACAAAAAGTTGTACTTTCCA VSAK1_00115
Vibrio vulnificus CMCP6
Position: -93
Score: 5.54089
Sequence: TATACAAAAAAACAATCGGTATA
Locus tag: VV1_2936
Name: PF07366
Funciton: Protein of unknown function DUF1486
Locus tag: VV1_2935
Name: PF00106
Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
Locus tag: VV1_2934
Name: PF01593
Funciton: Flavin containing amine oxidoreductase
Locus tag: VV1_2933
Name: PF07103
Funciton: Protein of unknown function DUF1365
Locus tag: VV1_2932
Name: PF02353
Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
Locus tag: VV1_2931
Name: PF11086
Funciton: Protein of unknown function DUF2878
Locus tag: VV1_2930
Name: FIG026291
Funciton: FIG026291: Hypothetical periplasmic protein
Locus tag: VV1_2929
Name: FIG002577
Funciton: FIG002577: Putative lipoprotein precursor
PF07366-PF00106-PF01593-PF07103-PF02353-PF11086-FIG026291-FIG002577 -93 5.5 TATACAAAAAAACAATCGGTATA VV1_2936