Regulog PhrR - Vibrionales

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Light-dependent DNA repair
Effector:	Heat shock; Adenosylcobalamin
Phylum:	Proteobacteria/Gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - PhrR
By TF family - MerR
By effector - Heat shock
By effector - Adenosylcobalamin
By pathway - Light-dependent DNA repair

Statistics of regulated genes
Genome	Genes	Operons
Vibrio angustum S14	12	1
Vibrio cholerae O1 biovar eltor str. N16961	12	2
Vibrio fischeri ES114
Vibrio harveyi ATCC BAA-1116	12	2
Vibrio parahaemolyticus RIMD 2210633	12	2
Vibrio salmonicida LFI1238
Vibrio shilonii AK1	12	2
Vibrio splendidus LGP32
Vibrio vulnificus CMCP6	12	2
Photobacterium profundum SS9

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes											Function

CRON 1.
COG3272	2 Vibrio angustum S14* Gene: VAS14_11854: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA Site: position = -87 score = 6.15881 sequence = TATACAATAAAAAAACTTGTACA Gene: VAS14_11844: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -76 score = 6.74493 sequence = TGTACAAAAAAAATATTTGTACA Site: position = -28 score = 5.76117 sequence = TGTACAGAAATTTTCATTGTATA Gene: VCA0055: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	Vibrio fischeri ES114 Gene: VF_A0752: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	* Vibrio harveyi ATCC BAA-1116 Site: position = -81 score = 6.02085 sequence = TGTACATTTTATTTTCTTGTACA Site: position = -35 score = 6.10088 sequence = TATACAACAAAACATTTTGTATA Gene: VIBHAR_05120: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -83 score = 6.4178 sequence = TGTACAACTAATTTTCTTGTACA Site: position = -37 score = 6.20311 sequence = TATACAACTAAACTTTTTGTATA Gene: VPA1473: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	Vibrio salmonicida LFI1238 Gene: VSAL_II0865: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	* Vibrio shilonii AK1 Site: position = -78 score = 5.61234 sequence = TGTACAAGATAGAATTTTGTATC Gene: VSAK1_17997: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	Vibrio splendidus LGP32 Gene: VS_II1450: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	* Vibrio vulnificus CMCP6 Site: position = -35 score = 6.67285 sequence = TGTACAAGTAATTTTTTTGTACA Site: position = -81 score = 6.74493 sequence = TGTACAAAAAAAATATTTGTACA Gene: VV21541: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA	Photobacterium profundum SS9	COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
VAS14_11849	Vibrio angustum S14 Gene: VAS14_11849: hypothetical protein	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_04941: hypothetical protein	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA1560: hypothetical protein	Vibrio salmonicida LFI1238 Gene: VSAL_II0223: hypothetical protein	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_1177: hypothetical protein	Vibrio vulnificus CMCP6	Photobacterium profundum SS9 Gene: PBPRB0196: hypothetical protein	hypothetical protein
metY	Vibrio angustum S14 Gene: VAS14_11859: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48)	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633 Gene: VP0629: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48)	Vibrio salmonicida LFI1238	Vibrio shilonii AK1 Gene: VSAK1_14570: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48)	Vibrio splendidus LGP32 Gene: VS_0395: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48)	Vibrio vulnificus CMCP6	Photobacterium profundum SS9 Gene: PBPRB1415: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48)	O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48)
phrR	Vibrio angustum S14 Gene: VAS14_11864: Transcriptional regulator, MerR family, associated with photolyase	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0056: Transcriptional regulator, MerR family, associated with photolyase	Vibrio fischeri ES114	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_05121: Transcriptional regulator, MerR family, associated with photolyase	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA1472: Transcriptional regulator, MerR family, associated with photolyase	Vibrio salmonicida LFI1238	Vibrio shilonii AK1 Gene: VSAK1_17992: Transcriptional regulator, MerR family, associated with photolyase	Vibrio splendidus LGP32	Vibrio vulnificus CMCP6 Gene: VV21542: Transcriptional regulator, MerR family, associated with photolyase	Photobacterium profundum SS9	Transcriptional regulator, MerR family, associated with photolyase
phr	Vibrio angustum S14 Gene: VAS14_11869: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0057: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Vibrio fischeri ES114 Gene: VF_A0753: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_05122: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA1471: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Vibrio salmonicida LFI1238 Gene: VSAL_II0866: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Vibrio shilonii AK1 Gene: VSAK1_17987: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Vibrio splendidus LGP32 Gene: VS_II1451: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Vibrio vulnificus CMCP6 Gene: VV21543: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)	Photobacterium profundum SS9	Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
PF07366	Vibrio angustum S14 Gene: VAS14_11874: Protein of unknown function DUF1486	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -32 score = 5.57279 sequence = TATACGAATCTTAAATTTGTATA Gene: VC1118: Protein of unknown function DUF1486	Vibrio fischeri ES114 Gene: VF_A0764: Protein of unknown function DUF1486	* Vibrio harveyi ATCC BAA-1116 Site: position = -51 score = 6.47882 sequence = TGTACATATAATATTTTTGTACA Gene: VIBHAR_01814: Protein of unknown function DUF1486	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -51 score = 6.33457 sequence = TGTACATGTAATATTTTTGTACA Site: position = -96 score = 6.41387 sequence = TATACAAGTTTTTTTTTTGTACA Gene: VP1119: Protein of unknown function DUF1486	Vibrio salmonicida LFI1238	* Vibrio shilonii AK1 Site: position = -95 score = 4.60909 sequence = TATACAAAAAGTTGTACTTTCCA Gene: VSAK1_00115: Protein of unknown function DUF1486	Vibrio splendidus LGP32 Gene: VS_II1452: Protein of unknown function DUF1486	* Vibrio vulnificus CMCP6 Site: position = -93 score = 5.54089 sequence = TATACAAAAAAACAATCGGTATA Gene: VV1_2936: Protein of unknown function DUF1486	Photobacterium profundum SS9	Protein of unknown function DUF1486
PF00106	Vibrio angustum S14 Gene: VAS14_11879: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC1119: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Vibrio fischeri ES114 Gene: VF_A0763: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_01815: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Vibrio parahaemolyticus RIMD 2210633 Gene: VP1120: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Vibrio salmonicida LFI1238	Vibrio shilonii AK1 Gene: VSAK1_00120: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Vibrio splendidus LGP32 Gene: VS_II1453: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Vibrio vulnificus CMCP6 Gene: VV1_2935: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)	Photobacterium profundum SS9	Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
PF01593	Vibrio angustum S14 Gene: VAS14_11884: Flavin containing amine oxidoreductase	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC1120: Flavin containing amine oxidoreductase	Vibrio fischeri ES114 Gene: VF_A0762: Flavin containing amine oxidoreductase	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_01816: Flavin containing amine oxidoreductase	Vibrio parahaemolyticus RIMD 2210633 Gene: VP1121: Flavin containing amine oxidoreductase	Vibrio salmonicida LFI1238	Vibrio shilonii AK1 Gene: VSAK1_00125: Flavin containing amine oxidoreductase	Vibrio splendidus LGP32 Gene: VS_II1454: Flavin containing amine oxidoreductase	Vibrio vulnificus CMCP6 Gene: VV1_2934: Flavin containing amine oxidoreductase	Photobacterium profundum SS9	Flavin containing amine oxidoreductase
PF07103	Vibrio angustum S14 Gene: VAS14_11889: Protein of unknown function DUF1365	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC1121: Protein of unknown function DUF1365	Vibrio fischeri ES114 Gene: VF_A0761: Protein of unknown function DUF1365	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_01817: Protein of unknown function DUF1365	Vibrio parahaemolyticus RIMD 2210633 Gene: VP1122: Protein of unknown function DUF1365	Vibrio salmonicida LFI1238 Gene: VSAL_II0873: Protein of unknown function DUF1365	Vibrio shilonii AK1 Gene: VSAK1_00130: Protein of unknown function DUF1365	Vibrio splendidus LGP32 Gene: VS_II1455: Protein of unknown function DUF1365	Vibrio vulnificus CMCP6 Gene: VV1_2933: Protein of unknown function DUF1365	Photobacterium profundum SS9	Protein of unknown function DUF1365
PF02353	Vibrio angustum S14 Gene: VAS14_11894: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC1122: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Vibrio fischeri ES114 Gene: VF_A0760: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_01818: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Vibrio parahaemolyticus RIMD 2210633 Gene: VP1123: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Vibrio salmonicida LFI1238	Vibrio shilonii AK1 Gene: VSAK1_00135: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Vibrio splendidus LGP32 Gene: VS_II1456: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Vibrio vulnificus CMCP6 Gene: VV1_2932: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase	Photobacterium profundum SS9	S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
PF11086	Vibrio angustum S14 Gene: VAS14_11899: Protein of unknown function DUF2878	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC1123: Protein of unknown function DUF2878	Vibrio fischeri ES114 Gene: VF_A0759: Protein of unknown function DUF2878	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_01819: Protein of unknown function DUF2878	Vibrio parahaemolyticus RIMD 2210633 Gene: VP1124: Protein of unknown function DUF2878	Vibrio salmonicida LFI1238 Gene: VSAL_II0871: Protein of unknown function DUF2878	Vibrio shilonii AK1 Gene: VSAK1_00140: Protein of unknown function DUF2878	Vibrio splendidus LGP32 Gene: VS_II1457: Protein of unknown function DUF2878	Vibrio vulnificus CMCP6 Gene: VV1_2931: Protein of unknown function DUF2878	Photobacterium profundum SS9	Protein of unknown function DUF2878
FIG026291	Vibrio angustum S14 Gene: VAS14_11909: FIG026291: Hypothetical periplasmic protein	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC1124: FIG026291: Hypothetical periplasmic protein	Vibrio fischeri ES114 Gene: VF_A0758: FIG026291: Hypothetical periplasmic protein	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_01820: FIG026291: Hypothetical periplasmic protein	Vibrio parahaemolyticus RIMD 2210633 Gene: VP1125: FIG026291: Hypothetical periplasmic protein	Vibrio salmonicida LFI1238 Gene: VSAL_II0870: FIG026291: Hypothetical periplasmic protein	Vibrio shilonii AK1 Gene: VSAK1_00145: FIG026291: Hypothetical periplasmic protein	Vibrio splendidus LGP32 Gene: VS_II1458: FIG026291: Hypothetical periplasmic protein	Vibrio vulnificus CMCP6 Gene: VV1_2930: FIG026291: Hypothetical periplasmic protein	Photobacterium profundum SS9	FIG026291: Hypothetical periplasmic protein
FIG002577	Vibrio angustum S14 Gene: VAS14_11914: FIG002577: Putative lipoprotein precursor	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC1125: FIG002577: Putative lipoprotein precursor	Vibrio fischeri ES114 Gene: VF_A0757: FIG002577: Putative lipoprotein precursor	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_01821: FIG002577: Putative lipoprotein precursor	Vibrio parahaemolyticus RIMD 2210633 Gene: VP1126: FIG002577: Putative lipoprotein precursor	Vibrio salmonicida LFI1238 Gene: VSAL_II0869: FIG002577: Putative lipoprotein precursor	Vibrio shilonii AK1 Gene: VSAK1_00150: FIG002577: Putative lipoprotein precursor	Vibrio splendidus LGP32 Gene: VS_II1459: FIG002577: Putative lipoprotein precursor	Vibrio vulnificus CMCP6 Gene: VV1_2929: FIG002577: Putative lipoprotein precursor	Photobacterium profundum SS9 Gene: PBPRB0893: FIG002577: Putative lipoprotein precursor	FIG002577: Putative lipoprotein precursor
ykuD	Vibrio angustum S14 Gene: VAS14_11704: L,D-transpeptidase catalytic domain	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0058: L,D-transpeptidase catalytic domain	Vibrio fischeri ES114	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_05123: L,D-transpeptidase catalytic domain	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA1470: L,D-transpeptidase catalytic domain	Vibrio salmonicida LFI1238	Vibrio shilonii AK1 Gene: VSAK1_17982: L,D-transpeptidase catalytic domain	Vibrio splendidus LGP32 Gene: VS_II0198: L,D-transpeptidase catalytic domain	Vibrio vulnificus CMCP6 Gene: VV21544: L,D-transpeptidase catalytic domain	Photobacterium profundum SS9 Gene: PBPRB0743: L,D-transpeptidase catalytic domain	L,D-transpeptidase catalytic domain

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog PhrR - Vibrionales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --