Orthologous regulated operons containing PF00106 gene

Properties
Regulog:	PhrR - Vibrionales
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Light-dependent DNA repair
Effector:	Heat shock; Adenosylcobalamin
Phylum:	Proteobacteria/Gamma

Built upon 16 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Vibrio angustum S14
Position: -87 Score: 6.15881 Sequence: TATACAATAAAAAAACTTGTACA Locus tag: VAS14_11844 Name: COG3272 Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA Locus tag: VAS14_11849 Name: VAS14_11849 Funciton: hypothetical protein Locus tag: VAS14_11854 Name: COG3272 Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA Locus tag: VAS14_11859 Name: metY Funciton: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48) Locus tag: VAS14_11864 Name: phrR Funciton: Transcriptional regulator, MerR family, associated with photolyase Locus tag: VAS14_11869 Name: phr Funciton: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) Locus tag: VAS14_11874 Name: PF07366 Funciton: Protein of unknown function DUF1486 Locus tag: VAS14_11879 Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) Locus tag: VAS14_11884 Name: PF01593 Funciton: Flavin containing amine oxidoreductase Locus tag: VAS14_11889 Name: PF07103 Funciton: Protein of unknown function DUF1365 Locus tag: VAS14_11894 Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase Locus tag: VAS14_11899 Name: PF11086 Funciton: Protein of unknown function DUF2878
COG3272-VAS14_11849-COG3272-metY-phrR-phr-PF07366-PF00106-PF01593-PF07103-PF02353-PF11086	-87	6.2	TATACAATAAAAAAACTTGTACA	VAS14_11844
Vibrio cholerae O1 biovar eltor str. N16961
Position: -32 Score: 5.57279 Sequence: TATACGAATCTTAAATTTGTATA Locus tag: VC1118 Name: PF07366 Funciton: Protein of unknown function DUF1486 Locus tag: VC1119 Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) Locus tag: VC1120 Name: PF01593 Funciton: Flavin containing amine oxidoreductase Locus tag: VC1121 Name: PF07103 Funciton: Protein of unknown function DUF1365 Locus tag: VC1122 Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase Locus tag: VC1123 Name: PF11086 Funciton: Protein of unknown function DUF2878 Locus tag: VC1124 Name: FIG026291 Funciton: FIG026291: Hypothetical periplasmic protein Locus tag: VC1125 Name: FIG002577 Funciton: FIG002577: Putative lipoprotein precursor
PF07366-PF00106-PF01593-PF07103-PF02353-PF11086-FIG026291-FIG002577	-32	5.6	TATACGAATCTTAAATTTGTATA	VC1118
Vibrio harveyi ATCC BAA-1116
Position: -51 Score: 6.47882 Sequence: TGTACATATAATATTTTTGTACA Locus tag: VIBHAR_01814 Name: PF07366 Funciton: Protein of unknown function DUF1486 Locus tag: VIBHAR_01815 Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) Locus tag: VIBHAR_01816 Name: PF01593 Funciton: Flavin containing amine oxidoreductase Locus tag: VIBHAR_01817 Name: PF07103 Funciton: Protein of unknown function DUF1365 Locus tag: VIBHAR_01818 Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase Locus tag: VIBHAR_01819 Name: PF11086 Funciton: Protein of unknown function DUF2878 Locus tag: VIBHAR_01820 Name: FIG026291 Funciton: FIG026291: Hypothetical periplasmic protein Locus tag: VIBHAR_01821 Name: FIG002577 Funciton: FIG002577: Putative lipoprotein precursor
PF07366-PF00106-PF01593-PF07103-PF02353-PF11086-FIG026291-FIG002577	-51	6.5	TGTACATATAATATTTTTGTACA	VIBHAR_01814
Vibrio parahaemolyticus RIMD 2210633
Position: -96 Score: 6.41387 Sequence: TATACAAGTTTTTTTTTTGTACA Position: -51 Score: 6.33457 Sequence: TGTACATGTAATATTTTTGTACA Locus tag: VP1119 Name: PF07366 Funciton: Protein of unknown function DUF1486 Locus tag: VP1120 Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) Locus tag: VP1121 Name: PF01593 Funciton: Flavin containing amine oxidoreductase Locus tag: VP1122 Name: PF07103 Funciton: Protein of unknown function DUF1365 Locus tag: VP1123 Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase Locus tag: VP1124 Name: PF11086 Funciton: Protein of unknown function DUF2878 Locus tag: VP1125 Name: FIG026291 Funciton: FIG026291: Hypothetical periplasmic protein Locus tag: VP1126 Name: FIG002577 Funciton: FIG002577: Putative lipoprotein precursor
PF07366-PF00106-PF01593-PF07103-PF02353-PF11086-FIG026291-FIG002577	-96	6.4	TATACAAGTTTTTTTTTTGTACA	VP1119
	-51	6.3	TGTACATGTAATATTTTTGTACA
Vibrio shilonii AK1
Position: -95 Score: 4.60909 Sequence: TATACAAAAAGTTGTACTTTCCA Locus tag: VSAK1_00115 Name: PF07366 Funciton: Protein of unknown function DUF1486 Locus tag: VSAK1_00120 Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) Locus tag: VSAK1_00125 Name: PF01593 Funciton: Flavin containing amine oxidoreductase Locus tag: VSAK1_00130 Name: PF07103 Funciton: Protein of unknown function DUF1365 Locus tag: VSAK1_00135 Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase Locus tag: VSAK1_00140 Name: PF11086 Funciton: Protein of unknown function DUF2878 Locus tag: VSAK1_00145 Name: FIG026291 Funciton: FIG026291: Hypothetical periplasmic protein Locus tag: VSAK1_00150 Name: FIG002577 Funciton: FIG002577: Putative lipoprotein precursor
PF07366-PF00106-PF01593-PF07103-PF02353-PF11086-FIG026291-FIG002577	-95	4.6	TATACAAAAAGTTGTACTTTCCA	VSAK1_00115
Vibrio vulnificus CMCP6
Position: -93 Score: 5.54089 Sequence: TATACAAAAAAACAATCGGTATA Locus tag: VV1_2936 Name: PF07366 Funciton: Protein of unknown function DUF1486 Locus tag: VV1_2935 Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) Locus tag: VV1_2934 Name: PF01593 Funciton: Flavin containing amine oxidoreductase Locus tag: VV1_2933 Name: PF07103 Funciton: Protein of unknown function DUF1365 Locus tag: VV1_2932 Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase Locus tag: VV1_2931 Name: PF11086 Funciton: Protein of unknown function DUF2878 Locus tag: VV1_2930 Name: FIG026291 Funciton: FIG026291: Hypothetical periplasmic protein Locus tag: VV1_2929 Name: FIG002577 Funciton: FIG002577: Putative lipoprotein precursor
PF07366-PF00106-PF01593-PF07103-PF02353-PF11086-FIG026291-FIG002577	-93	5.5	TATACAAAAAAACAATCGGTATA	VV1_2936