Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing DvMF_2977 gene

Properties
Regulog: DVU2423 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: HxlR
Regulation mode:
Biological process: Nitrogen metabolism
Effector:
Phylum: Proteobacteria/delta
Built upon 9 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio vulgaris str. Miyazaki F
Position: -235
Score: 4.9535
Sequence: TGGTATGCCGCAGGATACTA
Locus tag: DvMF_2975
Name: DVU2422
Funciton: Nitroreductase family protein
Locus tag: DvMF_2976
Name: dmpI
Funciton: 4-oxalocrotonate tautomerase (EC 5.3.2.-)
Locus tag: DvMF_2977
Name: null
Funciton: NADH:flavin oxidoreductase/NADH oxidase
Locus tag: DvMF_2978
Name: null
Funciton: conserved hypothetical protein
Locus tag: DvMF_2979
Name: null
Funciton: NADPH-dependent FMN reductase
DVU2422-dmpI-DvMF_2977-DvMF_2978-DvMF_2979 -235 5 TGGTATGCCGCAGGATACTA DvMF_2975