Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Dbac_0453 gene

Properties
Regulog: DVU2423 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: HxlR
Regulation mode:
Biological process: Nitrogen metabolism
Effector:
Phylum: Proteobacteria/delta
Built upon 9 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfomicrobium baculatum DSM 4028
Position: -98
Score: 4.44409
Sequence: GTGTACCGTACATTATAGAC
Locus tag: Dbac_0455
Name: null
Funciton: NADPH-dependent FMN reductase
Locus tag: Dbac_0454
Name: null
Funciton: nitroreductase
Locus tag: Dbac_0453
Name: null
Funciton: protein of unknown function DUF6 transmembrane
Dbac_0455-Dbac_0454-Dbac_0453 -98 4.4 GTGTACCGTACATTATAGAC Dbac_0455