Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing gluK gene

Properties
Regulog: GluR - Thermotogales
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Glucose utilization; Trehalose utilization
Effector: Glucose
Phylum: Thermotogae
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermotoga naphthophila RKU-10
Position: -133
Score: 6.30633
Sequence: ATTTAATTCCTTTGGAAATTAAT
Locus tag: Tnap_0597
Name: gluE
Funciton: Glucose ABC transporter, substrate-binding component
Locus tag: Tnap_0596
Name: gluF
Funciton: Glucose ABC transporter, permease component
Locus tag: Tnap_0595
Name: gluK
Funciton: Glucose ABC transporter, ATP-binding component
Locus tag: Tnap_0594
Name: gluR
Funciton: Predicted regulator of glucose and trehalose utilization, ROK family
gluE-gluF-gluK-gluR -133 6.3 ATTTAATTCCTTTGGAAATTAAT Tnap_0597
Thermotoga neapolitana DSM 4359
Position: -121
Score: 6.26143
Sequence: ATTTGATTCCGTTGGAAATTAAT
Locus tag: CTN_0777
Name: gluE
Funciton: Glucose ABC transporter, substrate-binding component
Locus tag: CTN_0776
Name: gluF
Funciton: Glucose ABC transporter, permease component
Locus tag: CTN_0775
Name: gluK
Funciton: Glucose ABC transporter, ATP-binding component
Locus tag: CTN_0774
Name: gluR
Funciton: Predicted regulator of glucose and trehalose utilization, ROK family
gluE-gluF-gluK-gluR -121 6.3 ATTTGATTCCGTTGGAAATTAAT CTN_0777
Thermotoga sp. RQ2
Position: -121
Score: 6.30633
Sequence: ATTTAATTCCTTTGGAAATTAAT
Locus tag: TRQ2_0973
Name: gluE
Funciton: Glucose ABC transporter, substrate-binding component
Locus tag: TRQ2_0974
Name: gluF
Funciton: Glucose ABC transporter, permease component
Locus tag: TRQ2_0975
Name: gluK
Funciton: Glucose ABC transporter, ATP-binding component
Locus tag: TRQ2_0976
Name: gluR
Funciton: Predicted regulator of glucose and trehalose utilization, ROK family
gluE-gluF-gluK-gluR -121 6.3 ATTTAATTCCTTTGGAAATTAAT TRQ2_0973