Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing treG gene

Properties
Regulog: GluR - Thermotogales
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Glucose utilization; Trehalose utilization
Effector: Glucose
Phylum: Thermotogae
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermotoga naphthophila RKU-10
Position: -52
Score: 5.99096
Sequence: ATTTGATTATAACGTCATTTAAT
Locus tag: Tnap_0601
Name: amyE
Funciton: extracellular alpha-amylase precursor
Locus tag: Tnap_0600
Name: treE
Funciton: Trehalose ABC transporter, substrate-binding component
Locus tag: Tnap_0599
Name: treF
Funciton: Trehalose ABC transporter, permease component 1
Locus tag: Tnap_0598
Name: treG
Funciton: Trehalose ABC transporter, permease component 1
amyE-treE-treF-treG -52 6 ATTTGATTATAACGTCATTTAAT Tnap_0601
Thermotoga neapolitana DSM 4359
Position: -387
Score: 4.82591
Sequence: ATTTgATTAtAccGTcAgTTAAc
Locus tag: CTN_0781
Name: amyE
Funciton: extracellular alpha-amylase precursor
Locus tag: CTN_0780
Name: treE
Funciton: Trehalose ABC transporter, substrate-binding component
Locus tag: CTN_0779
Name: treF
Funciton: Trehalose ABC transporter, permease component 1
Locus tag: CTN_0778
Name: treG
Funciton: Trehalose ABC transporter, permease component 1
amyE-treE-treF-treG -387 4.8 ATTTgATTAtAccGTcAgTTAAc CTN_0781
Thermotoga petrophila RKU-1
Position: -52
Score: 5.99096
Sequence: ATTTGATTATAACGTCATTTAAT
Locus tag: Tpet_0953
Name: amyE
Funciton: extracellular alpha-amylase precursor
Locus tag: Tpet_0954
Name: treE
Funciton: Trehalose ABC transporter, substrate-binding component
Locus tag: Tpet_0955
Name: treF
Funciton: Trehalose ABC transporter, permease component 1
Locus tag: Tpet_0956
Name: treG
Funciton: Trehalose ABC transporter, permease component 1
Locus tag: Tpet_0957
Name: gluR
Funciton: Predicted regulator of glucose and trehalose utilization, ROK family
amyE-treE-treF-treG-gluR -52 6 ATTTGATTATAACGTCATTTAAT Tpet_0953
Thermotoga sp. RQ2
Position: -48
Score: 5.99096
Sequence: ATTTGATTACAACGTCATTTAAC
Locus tag: TRQ2_0970
Name: treE
Funciton: Trehalose ABC transporter, substrate-binding component
Locus tag: TRQ2_0971
Name: treF
Funciton: Trehalose ABC transporter, permease component 1
Locus tag: TRQ2_0972
Name: treG
Funciton: Trehalose ABC transporter, permease component 1
treE-treF-treG -48 6 ATTTGATTACAACGTCATTTAAC TRQ2_0970