Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing bglF gene

Properties
Regulog: BglR - Thermotogales
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Cellobiose
Phylum: Thermotogae
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermotoga maritima MSB8
Position: -45
Score: 6.78518
Sequence: AATTTCTTTCTGAGGAAGATAGA
Locus tag: TM0032
Name: bglR
Funciton: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family
Locus tag: TM0031
Name: bglE
Funciton: Beta-glucoside ABC transport system, sugar-binding protein
Locus tag: TM0030
Name: bglF
Funciton: Beta-glucoside ABC transport system, permease protein 1
Locus tag: TM0029
Name: bglG
Funciton: Beta-glucoside ABC transport system, permease protein 2
Locus tag: TM0028
Name: bglK
Funciton: Beta-glucoside ABC transport system, ATP-binding protein 1
Locus tag: TM0027
Name: bglL
Funciton: Beta-glucoside ABC transport system, ATP-binding protein 2
Locus tag: TM0026
Name: TM0026
Funciton: Hypothetical protein TM0026, BglR regulon
Locus tag: TM0025
Name: bglB
Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: TM0024
Name: lamA
Funciton: Laminarinase (EC 3.2.1.39)
bglR-bglE-bglF-bglG-bglK-bglL-TM0026-bglB-lamA -45 6.8 AATTTCTTTCTGAGGAAGATAGA TM0032
Thermotoga naphthophila RKU-10
Position: -45
Score: 6.78518
Sequence: AATTTCTTTCTGAGGAAGATAGA
Locus tag: Tnap_0663
Name: bglR
Funciton: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family
Locus tag: Tnap_0662
Name: bglE
Funciton: Beta-glucoside ABC transport system, sugar-binding protein
Locus tag: Tnap_0661
Name: bglF
Funciton: Beta-glucoside ABC transport system, permease protein 1
Locus tag: Tnap_0660
Name: bglG
Funciton: Beta-glucoside ABC transport system, permease protein 2
Locus tag: Tnap_0659
Name: bglK
Funciton: Beta-glucoside ABC transport system, ATP-binding protein 1
Locus tag: Tnap_0658
Name: bglL
Funciton: Beta-glucoside ABC transport system, ATP-binding protein 2
Locus tag: Tnap_0657
Name: TM0026
Funciton: Hypothetical protein TM0026, BglR regulon
Locus tag: Tnap_0656
Name: bglB
Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: Tnap_0655
Name: lamA
Funciton: Laminarinase (EC 3.2.1.39)
bglR-bglE-bglF-bglG-bglK-bglL-TM0026-bglB-lamA -45 6.8 AATTTCTTTCTGAGGAAGATAGA Tnap_0663
Thermotoga neapolitana DSM 4359
Position: -49
Score: 6.45303
Sequence: AATTCCTTTCTGAGGAAGATAAT
Locus tag: CTN_0660
Name: bglX
Funciton: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653
Locus tag: CTN_0661
Name: bglY
Funciton: Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175
Locus tag: CTN_0662
Name: bglZ
Funciton: Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395
Locus tag: CTN_0663
Name: bglR
Funciton: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family
Locus tag: CTN_0664
Name: bglE
Funciton: Beta-glucoside ABC transport system, sugar-binding protein
Locus tag: CTN_0665
Name: bglF
Funciton: Beta-glucoside ABC transport system, permease protein 1
Locus tag: CTN_0666
Name: bglG
Funciton: Beta-glucoside ABC transport system, permease protein 2
Locus tag: CTN_0667
Name: bglK
Funciton: Beta-glucoside ABC transport system, ATP-binding protein 1
Locus tag: CTN_0668
Name: bglL
Funciton: Beta-glucoside ABC transport system, ATP-binding protein 2
Locus tag: CTN_0669
Name: TM0026
Funciton: Hypothetical protein TM0026, BglR regulon
Locus tag: CTN_0670
Name: bglB
Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: CTN_0671
Name: lamA
Funciton: Laminarinase (EC 3.2.1.39)
bglX-bglY-bglZ-bglR-bglE-bglF-bglG-bglK-bglL-TM0026-bglB-lamA -49 6.5 AATTCCTTTCTGAGGAAGATAAT CTN_0660
Thermotoga petrophila RKU-1
Position: 29
Score: 6.78518
Sequence: AATtTCTTTCTGAGgAAGATAga
Locus tag: Tpet_0891
Name: bglR
Funciton: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family
Locus tag: Tpet_0892
Name: bglE
Funciton: Beta-glucoside ABC transport system, sugar-binding protein
Locus tag: Tpet_0893
Name: bglF
Funciton: Beta-glucoside ABC transport system, permease protein 1
Locus tag: Tpet_0894
Name: bglG
Funciton: Beta-glucoside ABC transport system, permease protein 2
Locus tag: Tpet_0895
Name: bglK
Funciton: Beta-glucoside ABC transport system, ATP-binding protein 1
Locus tag: Tpet_0896
Name: bglL
Funciton: Beta-glucoside ABC transport system, ATP-binding protein 2
Locus tag: Tpet_0897
Name: TM0026
Funciton: Hypothetical protein TM0026, BglR regulon
Locus tag: Tpet_0898
Name: bglB
Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: Tpet_0899
Name: lamA
Funciton: Laminarinase (EC 3.2.1.39)
bglR-bglE-bglF-bglG-bglK-bglL-TM0026-bglB-lamA 29 6.8 AATtTCTTTCTGAGgAAGATAga Tpet_0891
Thermotoga sp. RQ2
Position: -45
Score: 6.78518
Sequence: AATTTCTTTCTGAGGAAGATAGA
Locus tag: TRQ2_0913
Name: bglR
Funciton: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family
Locus tag: TRQ2_0914
Name: bglE
Funciton: Beta-glucoside ABC transport system, sugar-binding protein
Locus tag: TRQ2_0915
Name: bglF
Funciton: Beta-glucoside ABC transport system, permease protein 1
Locus tag: TRQ2_0916
Name: bglG
Funciton: Beta-glucoside ABC transport system, permease protein 2
Locus tag: TRQ2_0917
Name: bglK
Funciton: Beta-glucoside ABC transport system, ATP-binding protein 1
Locus tag: TRQ2_0918
Name: bglL
Funciton: Beta-glucoside ABC transport system, ATP-binding protein 2
Locus tag: TRQ2_0919
Name: TM0026
Funciton: Hypothetical protein TM0026, BglR regulon
Locus tag: TRQ2_0920
Name: bglB
Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: TRQ2_0921
Name: lamA
Funciton: Laminarinase (EC 3.2.1.39)
bglR-bglE-bglF-bglG-bglK-bglL-TM0026-bglB-lamA -45 6.8 AATTTCTTTCTGAGGAAGATAGA TRQ2_0913