Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing afrR gene

Properties
Regulog: AfrR - Rhizobiales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: 1,5-Anhydro-d-Fructose utilization
Effector:
Phylum: Proteobacteria/Alpha
Built upon 19 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Brucella melitensis 16M
Position: -154
Score: 5.87757
Sequence: AGTTTAGAACGTTCCAAATG
Locus tag: BMEI0019
Name: afrR
Funciton: Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family
Locus tag: BMEI0020
Name: afr
Funciton: 1,5-anhydro-D-fructose reductase EC=1.1.1.292
Locus tag: BMEI0021
Name: ydiF
Funciton: putative CoA-transferase
Locus tag: BMEI0022
Name: crt
Funciton: putative enoyl-CoA hydratase
Locus tag: BMEI0023
Name: crt
Funciton: putative enoyl-CoA hydratase
Locus tag: BMEI0024
Name: aldh
Funciton: putative aldehyde dehydrogenase
Locus tag: BMEI0025
Name: null
Funciton: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
Locus tag: BMEI0026
Name: fabG
Funciton: putative oxidoreductase
Locus tag: BMEI0027
Name: null
Funciton: Oxidoreductase, GMC family
Locus tag: BMEI0028
Name: null
Funciton: Oxidoreductase, GMC family
Locus tag: BMEI0029
Name: null
Funciton: Oxidoreductase, GMC family
afrR-afr-ydiF -crt-crt-aldh-BMEI0025-fabG-BMEI0027-BMEI0028-BMEI0029 -154 5.9 AGTTTAGAACGTTCCAAATG BMEI0019
Mesorhizobium loti MAFF303099
Position: -216
Score: 5.56413
Sequence: TAAATGGAACGTTCCAATAA
Position: -52
Score: 5.65678
Sequence: GGATTAGAACGTTCCAATAG
Locus tag: mlr3045
Name: afrR
Funciton: Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family
Locus tag: mlr3046
Name: afr
Funciton: 1,5-anhydro-D-fructose reductase EC=1.1.1.292
Locus tag: mlr3047
Name: ydiF
Funciton: putative CoA-transferase
Locus tag: mlr3048
Name: crt
Funciton: putative enoyl-CoA hydratase
Locus tag: mlr3049
Name: aldh
Funciton: putative aldehyde dehydrogenase
Locus tag: mlr3050
Name: null
Funciton: Sugar ABC transporter, substrate-binding protein
Locus tag: mlr3052
Name: null
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: mlr3053
Name: null
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: mlr3054
Name: null
Funciton: Sugar ABC transporter, ATP-binding protein
Locus tag: mlr3056
Name: null
Funciton: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
Locus tag: mlr3057
Name: fabG
Funciton: putative oxidoreductase
Locus tag: mlr3058
Name: null
Funciton: Oxidoreductase, GMC family
Locus tag: mlr3059
Name: null
Funciton: hypothetical protein
afrR-afr-ydiF -crt-aldh-mlr3050-mlr3052-mlr3053-mlr3054-mlr3056-fabG-mlr3058-mlr3059 -216 5.6 TAAATGGAACGTTCCAATAA mlr3045
-52 5.7 GGATTAGAACGTTCCAATAG
Rhizobium etli CFN 42
Position: -153
Score: 5.20615
Sequence: GATTTAAATCGTTCCAAAAG
Position: -57
Score: 6.00122
Sequence: TTTTTGGAACGTTCCAAATA
Locus tag: RHE_CH01719
Name: afrR
Funciton: Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family
Locus tag: RHE_CH01720
Name: ydiF
Funciton: putative CoA-transferase
Locus tag: RHE_CH01721
Name: crt
Funciton: putative enoyl-CoA hydratase
Locus tag: RHE_CH01722
Name: aldh
Funciton: putative aldehyde dehydrogenase
Locus tag: RHE_CH01723
Name: null
Funciton: Sugar ABC transporter, substrate-binding protein
Locus tag: RHE_CH01724
Name: null
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: RHE_CH01725
Name: null
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: RHE_CH01726
Name: null
Funciton: Sugar ABC transporter, ATP-binding protein
Locus tag: RHE_CH01727
Name: null
Funciton: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
Locus tag: RHE_CH01728
Name: null
Funciton: Oxidoreductase, GMC family
Locus tag: RHE_CH01729
Name: null
Funciton: putative oxidoreductase
Locus tag: RHE_CH01730
Name: null
Funciton: putative oxidoreductase protein
afrR-ydiF -crt-aldh-RHE_CH01723-RHE_CH01724-RHE_CH01725-RHE_CH01726-RHE_CH01727-RHE_CH01728-RHE_CH01729-RHE_CH01730 -153 5.2 GATTTAAATCGTTCCAAAAG RHE_CH01719
-57 6 TTTTTGGAACGTTCCAAATA
Rhizobium leguminosarum bv. viciae 3841
Position: -161
Score: 5.78575
Sequence: TTTTTAGATCGTTCCAAATT
Position: -56
Score: 6.18712
Sequence: CAATTGGAACGTTCCAAATA
Locus tag: RL1820
Name: afrR
Funciton: Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family
Locus tag: RL1821
Name: ydiF
Funciton: putative CoA-transferase
Locus tag: RL1822
Name: crt
Funciton: putative enoyl-CoA hydratase
Locus tag: RL1823
Name: aldh
Funciton: putative aldehyde dehydrogenase
Locus tag: RL1824
Name: null
Funciton: Sugar ABC transporter, substrate-binding protein
Locus tag: RL1825
Name: null
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: RL1826
Name: null
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: RL1827
Name: null
Funciton: Sugar ABC transporter, ATP-binding protein
Locus tag: RL1828
Name: null
Funciton: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
Locus tag: RL1829
Name: null
Funciton: Oxidoreductase, GMC family
Locus tag: RL1830
Name: null
Funciton: putative oxidoreductase
Locus tag: RL1831
Name: null
Funciton: putative oxidoreductase protein
afrR-ydiF -crt-aldh-RL1824-RL1825-RL1826-RL1827-RL1828-RL1829-RL1830-RL1831 -161 5.8 TTTTTAGATCGTTCCAAATT RL1820
-56 6.2 CAATTGGAACGTTCCAAATA
Rhizobium sp. NGR234
Position: -254
Score: 6.01999
Sequence: AATTTAGATCGTTCCAAATT
Position: -57
Score: 6.29205
Sequence: AAATTGGAACGTTCCAATTA
Locus tag: NGR_c33000
Name: afrR
Funciton: Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family
Locus tag: NGR_c33010
Name: afr
Funciton: 1,5-anhydro-D-fructose reductase EC=1.1.1.292
Locus tag: NGR_c33020
Name: ydiF
Funciton: putative CoA-transferase
Locus tag: NGR_c33030
Name: crt
Funciton: putative enoyl-CoA hydratase
Locus tag: NGR_c33040
Name: aldh
Funciton: putative aldehyde dehydrogenase
afrR-afr-ydiF -crt-aldh -254 6 AATTTAGATCGTTCCAAATT NGR_c33000
-57 6.3 AAATTGGAACGTTCCAATTA
Sinorhizobium meliloti 1021
Position: -261
Score: 6.01999
Sequence: AATTTAGATCGTTCCAAATT
Position: -57
Score: 6.29205
Sequence: AAATTGGAACGTTCCAATTA
Locus tag: SMc04401
Name: afrR
Funciton: Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family
Locus tag: SMc04400
Name: afr
Funciton: 1,5-anhydro-D-fructose reductase EC=1.1.1.292
Locus tag: SMc04399
Name: ydiF
Funciton: putative CoA-transferase
Locus tag: SMc04398
Name: crt
Funciton: putative enoyl-CoA hydratase
Locus tag: SMc04397
Name: aldh
Funciton: putative aldehyde dehydrogenase
Locus tag: SMc04396
Name: null
Funciton: Sugar ABC transporter, substrate-binding protein
Locus tag: SMc04395
Name: null
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: SMc04394
Name: null
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: SMc04393
Name: null
Funciton: Sugar ABC transporter, ATP-binding protein
Locus tag: SMc04392
Name: null
Funciton: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
Locus tag: SMc04391
Name: fabG
Funciton: putative oxidoreductase
afrR-afr-ydiF -crt-aldh-SMc04396-SMc04395-SMc04394-SMc04393-SMc04392-fabG -261 6 AATTTAGATCGTTCCAAATT SMc04401
-57 6.3 AAATTGGAACGTTCCAATTA
© 2009-2020 RegPrecise