Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing PF07992 gene

Properties
Regulog: Caur_3587 - Chloroflexia
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process:
Effector:
Phylum: Chloroflexi
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chloroflexus sp. Y-400-fl
Position: -43
Score: 6.00201
Sequence: ATATCGATGATCTTCGATAT
Locus tag: Chy400_3867
Name: PF07992
Funciton: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
Locus tag: Chy400_3866
Name: MFS
Funciton: transporter, major facilitator superfamily (MFS)
Locus tag: Chy400_3865
Name: PF07992
Funciton: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
PF07992-MFS-PF07992 -43 6 ATATCGATGATCTTCGATAT Chy400_3867