Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing bfrA gene

Properties
Regulog: BfrR - Chloroflexia
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructooligosaccharides utilization
Effector:
Phylum: Chloroflexi
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chloroflexus aggregans DSM 9485
Position: -46
Score: 6.3673
Sequence: GTCAATGGACGACCAATCTC
Locus tag: Cagg_3715
Name: bfrR
Funciton: Predicted transcriptional regulator for fructooligosaccharides utilization, LacI family
Locus tag: Cagg_3716
Name: bfrE
Funciton: Fructooligosaccharides ABC transporter, substrate-binding protein
Locus tag: Cagg_3717
Name: bfrF
Funciton: Fructooligosaccharides ABC transporter, permease protein 1
Locus tag: Cagg_3718
Name: bfrG
Funciton: Fructooligosaccharides ABC transporter, permease protein 2
Locus tag: Cagg_3719
Name: bfrA
Funciton: Beta-fructosidases (EC 3.2.1.26)
bfrR-bfrE-bfrF-bfrG-bfrA -46 6.4 GTCAATGGACGACCAATCTC Cagg_3715
Chloroflexus sp. Y-400-fl
Position: -46
Score: 6.17585
Sequence: GTCAATGAACGACCAATCTC
Locus tag: Chy400_2954
Name: bfrR
Funciton: Predicted transcriptional regulator for fructooligosaccharides utilization, LacI family
Locus tag: Chy400_2953
Name: bfrE
Funciton: Fructooligosaccharides ABC transporter, substrate-binding protein
Locus tag: Chy400_2952
Name: bfrF
Funciton: Fructooligosaccharides ABC transporter, permease protein 1
Locus tag: Chy400_2951
Name: bfrG
Funciton: Fructooligosaccharides ABC transporter, permease protein 2
Locus tag: Chy400_2950
Name: bfrA
Funciton: Beta-fructosidases (EC 3.2.1.26)
bfrR-bfrE-bfrF-bfrG-bfrA -46 6.2 GTCAATGAACGACCAATCTC Chy400_2954