Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing VV21328 gene

Properties
Regulog: GalR - Vibrionales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactose utilization
Effector: Galactose
Phylum: Proteobacteria/gamma
Built upon 30 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Vibrio vulnificus CMCP6
Position: -96
Score: 5.19872
Sequence: TCATGAAAACGTTTCCATAG
Locus tag: VV21329
Name: lacP
Funciton: predicted lactoporin
Locus tag: VV21328
Name: VV21328
Funciton: lactose operon periplasmic protein
Locus tag: VV2_1327
Name: lacZ
Funciton: Beta-galactosidase (EC 3.2.1.23)
lacP-VV21328-lacZ -96 5.2 TCATGAAAACGTTTCCATAG VV21329