Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Jann_1468 gene

Properties
Regulog: Jann_1459 - Rhodobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/Alpha
Built upon 10 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -92
Score: 5.40262
Sequence: GTATGTAATCGATTTCAGAG
Locus tag: Jann_1460
Name: null
Funciton: short-chain dehydrogenase/reductase SDR
Locus tag: Jann_1461
Name: Jann_1461
Funciton: oxidoreductase-like
Locus tag: Jann_1462
Name: COG1082
Funciton: Sugar phosphate isomerases/epimerases
Locus tag: Jann_1463
Name: SMb20720
Funciton: Sugar ABC transport system, substrate-binding protein
Locus tag: Jann_1464
Name: SMb20718
Funciton: Sugar ABC transport system, ATP-binding protein
Locus tag: Jann_1465
Name: SMb20719
Funciton: SugarABC transport system, inner membrane protein
Locus tag: Jann_1466
Name: SMb20719
Funciton: SugarABC transport system, inner membrane protein
Locus tag: Jann_1467
Name: COG0673
Funciton: Predicted dehydrogenases and related proteins
Locus tag: Jann_1468
Name: null
Funciton: oxidoreductase-like
Jann_1460-Jann_1461-COG1082-SMb20720-SMb20718-SMb20719-SMb20719-COG0673-Jann_1468 -92 5.4 GTATGTAATCGATTTCAGAG Jann_1460