Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing COG1082 gene

Properties
Regulog: Jann_1459 - Rhodobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/Alpha
Built upon 10 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -92
Score: 5.40262
Sequence: GTATGTAATCGATTTCAGAG
Locus tag: Jann_1460
Name: null
Funciton: short-chain dehydrogenase/reductase SDR
Locus tag: Jann_1461
Name: Jann_1461
Funciton: oxidoreductase-like
Locus tag: Jann_1462
Name: COG1082
Funciton: Sugar phosphate isomerases/epimerases
Locus tag: Jann_1463
Name: SMb20720
Funciton: Sugar ABC transport system, substrate-binding protein
Locus tag: Jann_1464
Name: SMb20718
Funciton: Sugar ABC transport system, ATP-binding protein
Locus tag: Jann_1465
Name: SMb20719
Funciton: SugarABC transport system, inner membrane protein
Locus tag: Jann_1466
Name: SMb20719
Funciton: SugarABC transport system, inner membrane protein
Locus tag: Jann_1467
Name: COG0673
Funciton: Predicted dehydrogenases and related proteins
Locus tag: Jann_1468
Name: null
Funciton: oxidoreductase-like
Jann_1460-Jann_1461-COG1082-SMb20720-SMb20718-SMb20719-SMb20719-COG0673-Jann_1468 -92 5.4 GTATGTAATCGATTTCAGAG Jann_1460
Oceanicola batsensis HTCC2597
Position: -50
Score: 5.07918
Sequence: GGATGTAATCGATTTCAAGG
Locus tag: OB2597_08884
Name: COG1082
Funciton: Sugar phosphate isomerases/epimerases
Locus tag: OB2597_08879
Name: COG0673
Funciton: Predicted dehydrogenases and related proteins
Locus tag: OB2597_08874
Name: null
Funciton: Putative isomerase/epimerase
Locus tag: OB2597_08869
Name: SMb20718
Funciton: Sugar ABC transport system, ATP-binding protein
Locus tag: OB2597_08864
Name: SMb20719
Funciton: SugarABC transport system, inner membrane protein
Locus tag: OB2597_08859
Name: SMb20719
Funciton: SugarABC transport system, inner membrane protein
Locus tag: OB2597_08854
Name: SMb20720
Funciton: Sugar ABC transport system, substrate-binding protein
COG1082-COG0673-OB2597_08874-SMb20718-SMb20719-SMb20719-SMb20720 -50 5.1 GGATGTAATCGATTTCAAGG OB2597_08884
Paracoccus denitrificans PD1222
Position: -54
Score: 4.91066
Sequence: GTTTGCAATCGATTGCAGAC
Locus tag: Pden_4767
Name: COG1082
Funciton: Sugar phosphate isomerases/epimerases
Locus tag: Pden_4768
Name: COG0673
Funciton: Predicted dehydrogenases and related proteins
Locus tag: Pden_4769
Name: SMb20718
Funciton: Sugar ABC transport system, ATP-binding protein
Locus tag: Pden_4770
Name: SMb20719
Funciton: SugarABC transport system, inner membrane protein
Locus tag: Pden_4771
Name: SMb20720
Funciton: Sugar ABC transport system, substrate-binding protein
COG1082-COG0673-SMb20718-SMb20719-SMb20720 -54 4.9 GTTTGCAATCGATTGCAGAC Pden_4767
Rhodobacter sphaeroides 2.4.1
Position: -109
Score: 4.3248
Sequence: CGTTGTAAACGTTTGTCGCG
Position: -77
Score: 5.70327
Sequence: CTCTGCAAACGATTACATCA
Locus tag: RSP_1244
Name: COG1082
Funciton: Sugar phosphate isomerases/epimerases
Locus tag: RSP_1245
Name: COG0673
Funciton: Predicted dehydrogenases and related proteins
Locus tag: RSP_1247
Name: SMb20718
Funciton: Sugar ABC transport system, ATP-binding protein
Locus tag: RSP_6150
Name: SMb20719
Funciton: SugarABC transport system, inner membrane protein
Locus tag: RSP_1249
Name: SMb20720
Funciton: Sugar ABC transport system, substrate-binding protein
COG1082-COG0673-SMb20718-SMb20719-SMb20720 -109 4.3 CGTTGTAAACGTTTGTCGCG RSP_1244
-77 5.7 CTCTGCAAACGATTACATCA