Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing czcC gene

Properties
Regulog: CadR-PbrR - Sphingomonadales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Alpha
Built upon 6 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Sphingobium japonicum UT26S
Position: -35
Score: 5.29693
Sequence: CTTCTACAGCGACTGGAGGTG
Locus tag: SJA_C1-05430
Name: czcD
Funciton: Co/Zn/Cd efflux protein
Locus tag: SJA_C1-05420
Name: pbrT
Funciton: Pb(II) uptake protein, ILT family
Locus tag: SJA_C1-05410
Name: null
Funciton: hypothetical protein
Locus tag: SJA_C1-05400
Name: czcC
Funciton: Heavy metal efflux RND outer membrane protein
Locus tag: SJA_C1-05390
Name: czcB
Funciton: Heavy metal efflux RND transporter, membrane fusion protein
Locus tag: SJA_C1-05380
Name: czcA
Funciton: Heavy metal efflux RND transmembrane protein
Locus tag: SJA_C1-05370
Name: null
Funciton: hypothetical protein
Locus tag: SJA_C1-05360
Name: null
Funciton: hypothetical protein
Locus tag: SJA_C1-05350
Name: null
Funciton: hypothetical protein
Locus tag: SJA_C1-05340
Name: PF02535
Funciton: Putative metal transporter
Locus tag: SJA_C1-05330
Name: czcD2
Funciton: Co/Zn/Cd efflux protein
Locus tag: SJA_C1-05320
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
czcD-pbrT-SJA_C1-05410-czcC-czcB-czcA-SJA_C1-05370-SJA_C1-05360-SJA_C1-05350-PF02535-czcD2-cadA -35 5.3 CTTCTACAGCGACTGGAGGTG SJA_C1-05430
Sphingopyxis alaskensis RB2256
Position: -19
Score: 6.19031
Sequence: ATCCTCCAGTGACTGGAGGAT
Locus tag: Sala_2444
Name: czcD
Funciton: Co/Zn/Cd efflux protein
Locus tag: Sala_2445
Name: null
Funciton: hypothetical protein
Locus tag: Sala_2446
Name: null
Funciton: hypothetical protein
Locus tag: Sala_2447
Name: czcC
Funciton: Heavy metal efflux RND outer membrane protein
Locus tag: Sala_2448
Name: czcB
Funciton: Heavy metal efflux RND transporter, membrane fusion protein
Locus tag: Sala_2449
Name: czcA
Funciton: Heavy metal efflux RND transmembrane protein
czcD-Sala_2445-Sala_2446-czcC-czcB-czcA -19 6.2 ATCCTCCAGTGACTGGAGGAT Sala_2444