Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing copG gene

Properties
Regulog: CueR - Ralstonia
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/beta
Built upon 18 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Ralstonia metallidurans CH34
Position: -349
Score: 5.75672
Sequence: ACCTTCCCATGGCGGGAAGGA
Locus tag: Rmet_6119
Name: copA2
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Rmet_6118
Name: copG
Funciton: CopG protein
copA2-copG -349 5.8 ACCTTCCCATGGCGGGAAGGA Rmet_6119