Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing ruvB gene

Properties
Regulog: LexA - Various betaproteobacteria
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Proteobacteria/beta
Built upon 12 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Dechloromonas aromatica RCB
Position: -47
Score: 5.71081
Sequence: AACTGTGTGAAAATACAGTA
Locus tag: Daro_4062
Name: ruvA
Funciton: Holliday junction DNA helicase RuvA
Locus tag: Daro_4061
Name: yhhT
Funciton: Putative membrane protein
Locus tag: Daro_4060
Name: ruvB
Funciton: Holliday junction DNA helicase RuvB
ruvA-yhhT-ruvB -47 5.7 AACTGTGTGAAAATACAGTA Daro_4062