Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing ccmG gene

Properties
Regulog: Irr - Rhizobiales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Built upon 122 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bartonella quintana str. Toulouse
Position: -98
Score: 5.18756
Sequence: TTTCTAGAACTATTCTAGATA
Locus tag: BQ01080
Name: ccmA
Funciton: heme ABC transporter, ATPase subunit
Locus tag: BQ01070
Name: ccmB
Funciton: heme ABC transporter, permease subunit
Locus tag: BQ01060
Name: ccmC
Funciton: Cytochrome c-type biogenesis protein, heme lyase
Locus tag: BQ01050
Name: ccmD
Funciton: Cytochrome c-type biogenesis protein, interacts with CcmCE
Locus tag: BQ01040
Name: ccmG
Funciton: Cytochrome c-type biogenesis protein, thiol:disulfide oxidoreductase
ccmA-ccmB-ccmC-ccmD-ccmG -98 5.2 TTTCTAGAACTATTCTAGATA BQ01080
Mesorhizobium loti MAFF303099
Position: -86
Score: 5.04492
Sequence: TTTCTGGAATAGTTCTAGACA
Locus tag: mll4333
Name: ccmA
Funciton: heme ABC transporter, ATPase subunit
Locus tag: mll4332
Name: ccmB
Funciton: heme ABC transporter, permease subunit
Locus tag: msl4331
Name: ccmD
Funciton: Cytochrome c-type biogenesis protein, interacts with CcmCE
Locus tag: mll4330
Name: ccmG
Funciton: Cytochrome c-type biogenesis protein, thiol:disulfide oxidoreductase
ccmA-ccmB-ccmD-ccmG -86 5 TTTCTGGAATAGTTCTAGACA mll4333