Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing ygjK gene

Properties
Regulog: EbgR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector: Beta-galactosides
Phylum: Proteobacteria/gamma
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Escherichia coli str. K-12 substr. MG1655
Position: -94
Score: 6.24544
Sequence: CTACTTTTTAGTAAAAATTTT
Locus tag: b3076
Name: ebgA
Funciton: Evolved beta-D-galactosidase, alpha subunit
Locus tag: b3077
Name: ebgC
Funciton: Evolved beta-D-galactosidase, beta subunit
Locus tag: b3078
Name: ygjI
Funciton: predicted beta-galactoside transporter, AAP family
Locus tag: b3079
Name: ygjJ
Funciton: hypothetical protein
Locus tag: b3080
Name: ygjK
Funciton: predicted glycosyl hydrolase
ebgA-ebgC-ygjI-ygjJ-ygjK -94 6.2 CTACTTTTTAGTAAAAATTTT b3076
Serratia proteamaculans 568
Position: -160
Score: 6.43443
Sequence: GTATTTTTTACTAAATATTTT
Locus tag: Spro_1971
Name: ygjJ
Funciton: hypothetical protein
Locus tag: Spro_1970
Name: ygjK
Funciton: predicted glycosyl hydrolase
ygjJ-ygjK -160 6.4 GTATTTTTTACTAAATATTTT Spro_1971
© 2009-2020 RegPrecise