Orthologous regulated operons containing BC2909 gene

Properties
Regulog:	CymR - Bacillales
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine; CysK, cysteine synthetase
Phylum:	Firmicutes

Built upon 65 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bacillus cereus ATCC 14579
Position: -174 Score: 5.71562 Sequence: TAAAACCTAGTTGACTTATCGGAAATA Locus tag: BC2912 Name: ssuB Funciton: Aliphatic sulfonate ABC transporter (ATP-binding protein) Locus tag: BC2911 Name: ssuA Funciton: Aliphatic sulfonate ABC transporter (binding lipoprotein) Locus tag: BC2910 Name: null Funciton: Alkanesulfonates transport system permease protein Locus tag: BC2909 Name: null Funciton: Alkanesulfonate monooxygenase
ssuB-ssuA-BC2910-BC2909	-174	5.7	TAAAACCTAGTTGACTTATCGGAAATA	BC2912

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --