Orthologous regulated operons containing Pjdr2_0762 gene

Properties
Regulog:	CymR - Bacillales
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine; CysK, cysteine synthetase
Phylum:	Firmicutes

Built upon 65 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Paenibacillus sp. JDR-2
Position: -50 Score: 5.2029 Sequence: TAAATCCGATTAAACAAATAAGTAAAG Locus tag: Pjdr2_0760 Name: ssuA Funciton: Aliphatic sulfonate ABC transporter (binding lipoprotein) Locus tag: Pjdr2_0761 Name: null Funciton: Taurine dioxygenase Locus tag: Pjdr2_0762 Name: null Funciton: Stress responsive alpha-beta barrel domain protein
ssuA-Pjdr2_0761-Pjdr2_0762	-50	5.2	TAAATCCGATTAAACAAATAAGTAAAG	Pjdr2_0760

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --