Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Pjdr2_0761 gene

Properties
Regulog: CymR - Bacillales
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Phylum: Firmicutes
Built upon 65 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Paenibacillus sp. JDR-2
Position: -50
Score: 5.2029
Sequence: TAAATCCGATTAAACAAATAAGTAAAG
Locus tag: Pjdr2_0760
Name: ssuA
Funciton: Aliphatic sulfonate ABC transporter (binding lipoprotein)
Locus tag: Pjdr2_0761
Name: null
Funciton: Taurine dioxygenase
Locus tag: Pjdr2_0762
Name: null
Funciton: Stress responsive alpha-beta barrel domain protein
ssuA-Pjdr2_0761-Pjdr2_0762 -50 5.2 TAAATCCGATTAAACAAATAAGTAAAG Pjdr2_0760