Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing rbfK gene

Properties
Regulog: CymR - Bacillales
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Phylum: Firmicutes
Built upon 65 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus subtilis subsp. subtilis str. 168
Position: -54
Score: 5.65003
Sequence: AAAAGCTTAGTAAACAAATAGGAATTA
Locus tag: BSU29390
Name: ytmI
Funciton: Putative N-acetyltransferase
Locus tag: BSU29380
Name: ytmJ
Funciton: Sulfur containing amino acid ABC transporter binding lipoprotein
Locus tag: BSU29370
Name: ytmK
Funciton: Sulfur-containing amino acid ABC transporter binding lipoprotein
Locus tag: BSU29360
Name: ytmL
Funciton: Sulfur-containing amino acid ABC transporter (permease)
Locus tag: BSU29350
Name: ytmM
Funciton: Sulfur-containing amino acid ABC transporter (permease)
Locus tag: BSU29340
Name: ytmN
Funciton: Sulfur-containing amino-acid ABC transporter (ATP-binding protein)
Locus tag: BSU29330
Name: ytmO
Funciton: putative monooxygenase
Locus tag: BSU29320
Name: ytnI
Funciton: glutaredoxin
Locus tag: BSU29310
Name: ytnJ
Funciton: Putative monooxygenase
Locus tag: BSU29300
Name: rbfK
Funciton: RNA-binding riboflavin kinase
Locus tag: BSU29290
Name: ytnL
Funciton: Putative aminohydrolase
Locus tag: BSU29280
Name: ytnM
Funciton: Hypothetical protein
ytmI-ytmJ-ytmK-ytmL-ytmM-ytmN-ytmO-ytnI-ytnJ-rbfK-ytnL-ytnM -54 5.7 AAAAGCTTAGTAAACAAATAGGAATTA BSU29390