Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing atpE gene

Properties
Regulog: Crp - Enterobacteriales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria/gamma
Built upon 2301 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -262
Score: 4.70779
Sequence: ATATGTGATCCGAAGCACGCTT
Locus tag: CKO_00079
Name: atpI
Funciton: ATP synthase subunit I
Locus tag: CKO_00078
Name: atpB
Funciton: ATP synthase subunit A
Locus tag: CKO_00077
Name: atpE
Funciton: ATP synthase subunit C
Locus tag: CKO_00076
Name: atpF
Funciton: ATP synthase subunit B
Locus tag: CKO_00075
Name: atpH
Funciton: ATP synthase subunit D
Locus tag: CKO_00073
Name: atpA
Funciton: ATP synthase subunit A
Locus tag: CKO_00071
Name: atpG
Funciton: ATP synthase subunit C
Locus tag: CKO_00070
Name: atpD
Funciton: ATP synthase subunit B
Locus tag: CKO_00069
Name: atpC
Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC -262 4.7 ATATGTGATCCGAAGCACGCTT CKO_00079
Edwardsiella tarda EIB202
Position: -297
Score: 3.72882
Sequence: AATCGTGAAAATATTTAAATTA
Locus tag: ETAE_3526
Name: atpI
Funciton: ATP synthase subunit I
Locus tag: ETAE_3527
Name: atpB
Funciton: ATP synthase subunit A
Locus tag: ETAE_3528
Name: atpE
Funciton: ATP synthase subunit C
Locus tag: ETAE_3529
Name: atpF
Funciton: ATP synthase subunit B
Locus tag: ETAE_3530
Name: atpH
Funciton: ATP synthase subunit D
Locus tag: ETAE_3531
Name: atpA
Funciton: ATP synthase subunit A
Locus tag: ETAE_3532
Name: atpG
Funciton: ATP synthase subunit C
Locus tag: ETAE_3533
Name: atpD
Funciton: ATP synthase subunit B
Locus tag: ETAE_3534
Name: atpC
Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC -297 3.7 AATCGTGAAAATATTTAAATTA ETAE_3526
Enterobacter sp. 638
Position: -261
Score: 4.79394
Sequence: TTTTGTGATCTCGTGCACGCTT
Locus tag: Ent638_4125
Name: atpI
Funciton: ATP synthase subunit I
Locus tag: Ent638_4126
Name: atpB
Funciton: ATP synthase subunit A
Locus tag: Ent638_4127
Name: atpE
Funciton: ATP synthase subunit C
Locus tag: Ent638_4128
Name: atpF
Funciton: ATP synthase subunit B
Locus tag: Ent638_4129
Name: atpH
Funciton: ATP synthase subunit D
Locus tag: Ent638_4130
Name: atpA
Funciton: ATP synthase subunit A
Locus tag: Ent638_4131
Name: atpG
Funciton: ATP synthase subunit C
Locus tag: Ent638_4132
Name: atpD
Funciton: ATP synthase subunit B
Locus tag: Ent638_4133
Name: atpC
Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC -261 4.8 TTTTGTGATCTCGTGCACGCTT Ent638_4125
Erwinia amylovora ATCC 49946
Position: -264
Score: 4.38819
Sequence: ATTTGTGATCGTGGACACGCTT
Locus tag: EAM_3481
Name: atpI
Funciton: ATP synthase subunit I
Locus tag: EAM_3480
Name: atpB
Funciton: ATP synthase subunit A
Locus tag: EAM_3479
Name: atpE
Funciton: ATP synthase subunit C
Locus tag: EAM_3478
Name: atpF
Funciton: ATP synthase subunit B
Locus tag: EAM_3477
Name: atpH
Funciton: ATP synthase subunit D
Locus tag: EAM_3476
Name: atpA
Funciton: ATP synthase subunit A
Locus tag: EAM_3475
Name: atpG
Funciton: ATP synthase subunit C
Locus tag: EAM_3474
Name: atpD
Funciton: ATP synthase subunit B
Locus tag: EAM_3473
Name: atpC
Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC -264 4.4 ATTTGTGATCGTGGACACGCTT EAM_3481
Erwinia carotovora subsp. atroseptica SCRI1043
Position: -254
Score: 5.00697
Sequence: TTATGTGAGTCACATCACAGAT
Locus tag: ECA4519
Name: atpI
Funciton: ATP synthase subunit I
Locus tag: ECA4518
Name: atpB
Funciton: ATP synthase subunit A
Locus tag: ECA4517
Name: atpE
Funciton: ATP synthase subunit C
Locus tag: ECA4516
Name: atpF
Funciton: ATP synthase subunit B
Locus tag: ECA4515
Name: atpH
Funciton: ATP synthase subunit D
Locus tag: ECA4514
Name: atpA
Funciton: ATP synthase subunit A
Locus tag: ECA4513
Name: atpG
Funciton: ATP synthase subunit C
Locus tag: ECA4512
Name: atpD
Funciton: ATP synthase subunit B
Locus tag: ECA4511
Name: atpC
Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC -254 5 TTATGTGAGTCACATCACAGAT ECA4519
Escherichia coli str. K-12 substr. MG1655
Position: -263
Score: 4.79693
Sequence: ATATGTGATCTGAAGCACGCTT
Locus tag: b3739
Name: atpI
Funciton: ATP synthase subunit I
Locus tag: b3738
Name: atpB
Funciton: ATP synthase subunit A
Locus tag: b3737
Name: atpE
Funciton: ATP synthase subunit C
Locus tag: b3736
Name: atpF
Funciton: ATP synthase subunit B
Locus tag: b3735
Name: atpH
Funciton: ATP synthase subunit D
Locus tag: b3734
Name: atpA
Funciton: ATP synthase subunit A
Locus tag: b3733
Name: atpG
Funciton: ATP synthase subunit C
Locus tag: b3732
Name: atpD
Funciton: ATP synthase subunit B
Locus tag: b3731
Name: atpC
Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC -263 4.8 ATATGTGATCTGAAGCACGCTT b3739
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -262
Score: 4.74828
Sequence: TTATGTGATCTGATGCACGCTT
Locus tag: KPN_04144
Name: atpI
Funciton: ATP synthase subunit I
Locus tag: KPN_04143
Name: atpB
Funciton: ATP synthase subunit A
Locus tag: KPN_04142
Name: atpE
Funciton: ATP synthase subunit C
Locus tag: KPN_04141
Name: atpF
Funciton: ATP synthase subunit B
Locus tag: KPN_04140
Name: atpH
Funciton: ATP synthase subunit D
Locus tag: KPN_04139
Name: atpA
Funciton: ATP synthase subunit A
Locus tag: KPN_04138
Name: atpG
Funciton: ATP synthase subunit C
Locus tag: KPN_04137
Name: atpD
Funciton: ATP synthase subunit B
Locus tag: KPN_04136
Name: atpC
Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC -262 4.7 TTATGTGATCTGATGCACGCTT KPN_04144
Photorhabdus luminescens subsp. laumondii TTO1
Position: -265
Score: 5.72401
Sequence: TTATGTGATTTAAATCACATTT
Locus tag: plu0047
Name: atpI
Funciton: ATP synthase subunit I
Locus tag: plu0046
Name: atpB
Funciton: ATP synthase subunit A
Locus tag: plu0045
Name: atpE
Funciton: ATP synthase subunit C
Locus tag: plu0044
Name: atpF
Funciton: ATP synthase subunit B
Locus tag: plu0043
Name: atpH
Funciton: ATP synthase subunit D
Locus tag: plu0042
Name: atpA
Funciton: ATP synthase subunit A
Locus tag: plu0041
Name: atpG
Funciton: ATP synthase subunit C
Locus tag: plu0040
Name: atpD
Funciton: ATP synthase subunit B
Locus tag: plu0039
Name: atpC
Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC -265 5.7 TTATGTGATTTAAATCACATTT plu0047
Proteus mirabilis HI4320
Position: -259
Score: 5.04378
Sequence: TTGTGTGTTCTAGATCACATTA
Locus tag: PMI3057
Name: atpI
Funciton: ATP synthase subunit I
Locus tag: PMI3058
Name: atpB
Funciton: ATP synthase subunit A
Locus tag: PMI3059
Name: atpE
Funciton: ATP synthase subunit C
Locus tag: PMI3060
Name: atpF
Funciton: ATP synthase subunit B
Locus tag: PMI3061
Name: atpH
Funciton: ATP synthase subunit D
Locus tag: PMI3062
Name: atpA
Funciton: ATP synthase subunit A
Locus tag: PMI3063
Name: atpG
Funciton: ATP synthase subunit C
Locus tag: PMI3064
Name: atpD
Funciton: ATP synthase subunit B
Locus tag: PMI3065
Name: atpC
Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC -259 5 TTGTGTGTTCTAGATCACATTA PMI3057
Salmonella typhimurium LT2
Position: -262
Score: 4.64922
Sequence: ATGTGTGATCTGGTGCACGCTT
Position: -211
Score: 4.05602
Sequence: TTTTGTACGATCGTTCACACTT
Locus tag: STM3872
Name: atpI
Funciton: ATP synthase subunit I
Locus tag: STM3871
Name: atpB
Funciton: ATP synthase subunit A
Locus tag: STM3870
Name: atpE
Funciton: ATP synthase subunit C
Locus tag: STM3869
Name: atpF
Funciton: ATP synthase subunit B
Locus tag: STM3868
Name: atpH
Funciton: ATP synthase subunit D
Locus tag: STM3867
Name: atpA
Funciton: ATP synthase subunit A
Locus tag: STM3866
Name: atpG
Funciton: ATP synthase subunit C
Locus tag: STM3865
Name: atpD
Funciton: ATP synthase subunit B
Locus tag: STM3864
Name: atpC
Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC -262 4.6 ATGTGTGATCTGGTGCACGCTT STM3872
-211 4.1 TTTTGTACGATCGTTCACACTT
Serratia proteamaculans 568
Position: -265
Score: 4.38999
Sequence: TATTGTGAGCAACTACACGTTT
Locus tag: Spro_0001
Name: atpI
Funciton: ATP synthase subunit I
Locus tag: Spro_0002
Name: atpB
Funciton: ATP synthase subunit A
Locus tag: Spro_0003
Name: atpE
Funciton: ATP synthase subunit C
Locus tag: Spro_0004
Name: atpF
Funciton: ATP synthase subunit B
Locus tag: Spro_0005
Name: atpH
Funciton: ATP synthase subunit D
Locus tag: Spro_0006
Name: atpA
Funciton: ATP synthase subunit A
Locus tag: Spro_0007
Name: atpG
Funciton: ATP synthase subunit C
Locus tag: Spro_0008
Name: atpD
Funciton: ATP synthase subunit B
Locus tag: Spro_0009
Name: atpC
Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC -265 4.4 TATTGTGAGCAACTACACGTTT Spro_0001
Yersinia pestis KIM
Position: -263
Score: 5.42488
Sequence: TTATGTGATGTATTTCACGTTT
Locus tag: y4142
Name: atpI
Funciton: ATP synthase subunit I
Locus tag: y4141
Name: atpB
Funciton: ATP synthase subunit A
Locus tag: y4140
Name: atpE
Funciton: ATP synthase subunit C
Locus tag: y4139
Name: atpF
Funciton: ATP synthase subunit B
Locus tag: y4138
Name: atpH
Funciton: ATP synthase subunit D
Locus tag: y4137
Name: atpA
Funciton: ATP synthase subunit A
Locus tag: y4136
Name: atpG
Funciton: ATP synthase subunit C
Locus tag: y4135
Name: atpD
Funciton: ATP synthase subunit B
Locus tag: y4134
Name: atpC
Funciton: ATP synthase epsilon subunit
atpI-atpB-atpE-atpF-atpH-atpA-atpG-atpD-atpC -263 5.4 TTATGTGATGTATTTCACGTTT y4142