Regulon of LysX in Desulfovibrio desulfuricans G20

Properties
Regulator type:	Transcription factor
TF locus tag:	Dde_2665
Regulator family:	TrmB
Regulation mode:
Biological process:	Lysine biosynthesis
Effector:
Regulog:	LysX - Desulfovibrionales
Statistics of regulated genes:
- Genes	6
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - TrmB
By pathway - Lysine biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -42 Score: 6.4 Sequence: GTAGTACTAAATAGTACCAC Locus tag: Dde_2665 Name: lysX Funciton: Transcriptional regulator, TrmB family Locus tag: Dde_2664 Name: lysA-2 Funciton: Diaminopimelate decarboxylase (EC 4.1.1.20)
	Dde_2665	lysX	Transcriptional regulator, TrmB family
	Dde_2664	lysA-2	Diaminopimelate decarboxylase (EC 4.1.1.20)
Position: -385 Score: 5.2 Sequence: GTGTTTCTTATCACAACTAC Locus tag: Dde_2470 Name: null Funciton: hypothetical protein
	Dde_2470		hypothetical protein
Position: -83 Score: 5.9 Sequence: GTATTTCTATTTAGTACCAC Locus tag: Dde_0301 Name: null Funciton: Permease of the drug/metabolite transporter (DMT) superfamily
	Dde_0301		Permease of the drug/metabolite transporter (DMT) superfamily
Position: -144 Score: 5.4 Sequence: GGCGTTCTAAAGAGTACCAC Locus tag: Dde_0208 Name: lysW Funciton: lysine transporter from the Na+/H+ antiporter superfamily
	Dde_0208	lysW	lysine transporter from the Na+/H+ antiporter superfamily
Position: -274 Score: 5.2 Sequence: GTAGTTGTGATAAGAAACAC Locus tag: Dde_2468 Name: mviN-1 Funciton: integral membrane protein MviN
	Dde_2468	mviN-1	integral membrane protein MviN

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD