Regulon of DVU2423 in Desulfomicrobium baculatum DSM 4028

Properties
Regulator type:	Transcription factor
TF locus tag:	Dbac_0456
Regulator family:	HxlR
Regulation mode:
Biological process:	Nitrogen metabolism
Effector:
Regulog:	DVU2423 - Desulfovibrionales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - HxlR
By pathway - Nitrogen metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 4.4 Sequence: GTCTATAATGTACGGTACAC Locus tag: Dbac_0456 Name: null Funciton: Transcriptional regulator, HxlR family
	Dbac_0456		Transcriptional regulator, HxlR family
Position: -98 Score: 4.4 Sequence: GTGTACCGTACATTATAGAC Locus tag: Dbac_0455 Name: null Funciton: NADPH-dependent FMN reductase Locus tag: Dbac_0454 Name: null Funciton: nitroreductase Locus tag: Dbac_0453 Name: null Funciton: protein of unknown function DUF6 transmembrane
	Dbac_0455		NADPH-dependent FMN reductase
	Dbac_0454		nitroreductase
	Dbac_0453		protein of unknown function DUF6 transmembrane

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD