Regulon of AraR in Thermotoga neapolitana DSM 4359

Properties
Regulator type:	Transcription factor
TF locus tag:	CTN_0410
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Arabinose utilization
Effector:	Arabinose
Regulog:	AraR - Thermotogales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 35 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By trascription factor - AraR
By TF family - GntR/Others
By effector - Arabinose
By pathway - Arabinose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -136 Score: 6.2 Sequence: ACAAAAGTACGTACCTTTAT Position: -33 Score: 4.7 Sequence: CAACTGGTACGTACCGATAT Locus tag: CTN_0408 Name: araE Funciton: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein Locus tag: CTN_0406 Name: araF Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 1
	CTN_0408	araE	Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
	CTN_0406	araF	Predicted arabinosides or arabinose ABC transport system, permease protein 1
Position: -165 Score: 4.7 Sequence: ATATCGGTACGTACCAGTTG Position: -62 Score: 6.2 Sequence: ATAAAGGTACGTACTTTTGT Locus tag: CTN_0409 Name: araA Funciton: L-arabinose isomerase (EC 5.3.1.4)
	CTN_0409	araA	L-arabinose isomerase (EC 5.3.1.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD