Regulon of LexA in Staphylococcus carnosus subsp. carnosus TM300

Properties
Regulator type:	Transcription factor
TF locus tag:	Sca_0980
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Staphylococcaceae
Statistics of regulated genes:
- Genes	14
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 85 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 5.3 Sequence: TAGCGAACAAGTGTTCGTAT Locus tag: Sca_1497 Name: null Funciton: SPBc2 prophage-derived uncharacterized protein
	Sca_1497		SPBc2 prophage-derived uncharacterized protein
Position: -82 Score: 5.2 Sequence: AACAGAACATTTGTTCTTTA Position: -53 Score: 5.7 Sequence: ATAAGAACAAATGTTCGCAT Locus tag: Sca_1008 Name: uvrX Funciton: Putative UV-damage repair protein Locus tag: Sca_1009 Name: uvrX Funciton: Putative UV-damage repair protein
	Sca_1008	uvrX	Putative UV-damage repair protein
	Sca_1009	uvrX	Putative UV-damage repair protein
Position: -267 Score: 4.8 Sequence: CTGCGAACAGATGTTTGTAC Locus tag: Sca_0407 Name: uvrB Funciton: excinuclease ABC subunit B Locus tag: Sca_0408 Name: uvrA Funciton: exinuclease ABC subunit A
	Sca_0407	uvrB	excinuclease ABC subunit B
	Sca_0408	uvrA	exinuclease ABC subunit A
Position: -68 Score: 5.1 Sequence: GACCGAAAATATGTTCGTTT Locus tag: Sca_1672 Name: SA1975 Funciton: predicted membrane-bound hydrolase Locus tag: Sca_1671 Name: SA1974 Funciton: UDP-N-acetylglucosamine pyrophosphorylase Locus tag: Sca_1670 Name: SA1973 Funciton: hemolysin III
	Sca_1672	SA1975	predicted membrane-bound hydrolase
	Sca_1671	SA1974	UDP-N-acetylglucosamine pyrophosphorylase
	Sca_1670	SA1973	hemolysin III
Position: -126 Score: 5.5 Sequence: AACAGAACATATGTTCGATT Locus tag: Sca_0377 Name: SA0684 Funciton: putative permease Locus tag: Sca_0376 Name: SA0683 Funciton: 7-cyano-7-deazaguanine reductase
	Sca_0377	SA0684	putative permease
	Sca_0376	SA0683	7-cyano-7-deazaguanine reductase
Position: -102 Score: 5 Sequence: AATCGAACAAACATTCGCAA Locus tag: Sca_0926 Name: recA Funciton: recombinase A
	Sca_0926	recA	recombinase A
Position: -35 Score: 5.4 Sequence: TAACGAACGTATGTTTGTAG Locus tag: Sca_0995 Name: parE Funciton: DNA topoisomerase IV subunit B Locus tag: Sca_0996 Name: parC Funciton: DNA topoisomerase IV subunit A
	Sca_0995	parE	DNA topoisomerase IV subunit B
	Sca_0996	parC	DNA topoisomerase IV subunit A
Position: -132 Score: 4.7 Sequence: CCCAGAACATTTGTTTGCAT Position: -103 Score: 4.9 Sequence: ATCAGAACGATTGTTCGCTG Position: -74 Score: 5.5 Sequence: TTACGAACAAATGTTTGTAA Locus tag: Sca_0980 Name: lexA Funciton: SOS regulatory LexA protein
	Sca_0980	lexA	SOS regulatory LexA protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Staphylococcus carnosus subsp. carnosus TM300

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --