Regulon of IscR in Blautia hansenii DSM 20583

Properties
Regulator type:	Transcription factor
TF locus tag:	BLAHAN_03017
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Clostridia-3
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 5.6 Sequence: AGAAATCAGAGTAAAACAGTCGGAATTGA Locus tag: BLAHAN_03017 Name: iscR Funciton: Iron-sulfur cluster assembly transcription factor IscR Locus tag: BLAHAN_03016 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: BLAHAN_03015 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like Locus tag: BLAHAN_03014 Name: trmU Funciton: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
	BLAHAN_03017	iscR	Iron-sulfur cluster assembly transcription factor IscR
	BLAHAN_03016	iscS	Cysteine desulfurase (EC 2.8.1.7)
	BLAHAN_03015	iscU	Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
	BLAHAN_03014	trmU	tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD