Regulon of CblR in Thermoproteus neutrophilus V24Sta

Properties
Regulator type:	Transcription factor
TF locus tag:
Regulator family:
Regulation mode:
Biological process:	Cobalamin biosynthesis
Effector:
Regulog:	CblR - Thermoproteales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Thermoproteales
By trascription factor - CblR
By pathway - Cobalamin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -232 Score: 5.1 Sequence: TTAGGGATTTTTCTCCATCA Locus tag: Tneu_0292 Name: cbtA Funciton: Predicted cobalt transporter CbtA Locus tag: Tneu_0291 Name: cbiG Funciton: Cobalamin biosynthesis protein CbiG Locus tag: Tneu_0290 Name: cobD Funciton: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81) Locus tag: Tneu_0289 Name: cobS Funciton: Cobalamin-5-phosphate synthase CobS
	Tneu_0292	cbtA	Predicted cobalt transporter CbtA
	Tneu_0291	cbiG	Cobalamin biosynthesis protein CbiG
	Tneu_0290	cobD	L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)
	Tneu_0289	cobS	Cobalamin-5-phosphate synthase CobS
Position: -23 Score: 5.8 Sequence: TATGGGAAATTTGTCCCCTA Locus tag: Tneu_0378 Name: nrdD Funciton: Ribonucleotide reductase of class III (anaerobic), large subunit (EC 1.17.4.2) Locus tag: Tneu_0379 Name: nrdG Funciton: Ribonucleotide reductase of class III (anaerobic), activating protein (EC 1.97.1.4) Locus tag: Tneu_0380 Name: null Funciton: hypothetical protein
	Tneu_0378	nrdD	Ribonucleotide reductase of class III (anaerobic), large subunit (EC 1.17.4.2)
	Tneu_0379	nrdG	Ribonucleotide reductase of class III (anaerobic), activating protein (EC 1.97.1.4)
	Tneu_0380		hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD