Regulon of CymR in Staphylococcus capitis SK14

Properties
Regulator type:	Transcription factor
TF locus tag:	STACA0001_2394
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine; CysK, cysteine synthetase
Regulog:	CymR - Staphylococcaceae
Statistics of regulated genes:
- Genes	20
- Operons	9
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - Rrf2
By effector - O-acetyl-L-serine
By effector - CysK, cysteine synthetase
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -57 Score: 5.1 Sequence: ATATCCTTATTATATATGTCGGAATAC Locus tag: STACA0001_1450 Name: tcyP Funciton: L-cystine uptake protein tcyP
	STACA0001_1450	tcyP	L-cystine uptake protein tcyP
Position: -40 Score: 6 Sequence: TTATTCCGATTAGAATAATAAGATTAA Locus tag: STACA0001_1063 Name: tcyA Funciton: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA Locus tag: STACA0001_1064 Name: tcyB Funciton: L-cystine uptake ABC transporter, permease protein TcyB Locus tag: STACA0001_1065 Name: tcyC Funciton: L-cystine uptake ABC transporter, ATP-binding protein TcyC
	STACA0001_1063	tcyA	L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
	STACA0001_1064	tcyB	L-cystine uptake ABC transporter, permease protein TcyB
	STACA0001_1065	tcyC	L-cystine uptake ABC transporter, ATP-binding protein TcyC
Position: -57 Score: 4.2 Sequence: AAAAGTCGAGTGTTAAACTAGGATTAA Locus tag: STACA0001_1208 Name: SA2080 Funciton: putative acyl-CoA dehydrogenase
	STACA0001_1208	SA2080	putative acyl-CoA dehydrogenase
Position: -43 Score: 5.4 Sequence: ATATTCAGATAAGTATAATCAGAATTG Locus tag: STACA0001_1483 Name: metN2 Funciton: methionine ABC transporter paralog, ATP-binding protein MetN2 Locus tag: STACA0001_1484 Name: metP2 Funciton: methionine ABC transporter paralog, permease protein MetP2 Locus tag: STACA0001_1485 Name: metQ2 Funciton: methionine ABC transporter paralog, substrate-binding protein MetQ2
	STACA0001_1483	metN2	methionine ABC transporter paralog, ATP-binding protein MetN2
	STACA0001_1484	metP2	methionine ABC transporter paralog, permease protein MetP2
	STACA0001_1485	metQ2	methionine ABC transporter paralog, substrate-binding protein MetQ2
Position: -193 Score: 5.5 Sequence: TAATTATTACTTATTCTATCGGAATAA Locus tag: STACA0001_0838 Name: luxS Funciton: S-ribosylhomocysteinase
	STACA0001_0838	luxS	S-ribosylhomocysteinase
Position: -96 Score: 5.4 Sequence: TAATTCATACCTGATAAGTAAGAATTT Locus tag: STACA0001_1480 Name: mccA Funciton: cystathionine beta-synthase Locus tag: STACA0001_1481 Name: mccB Funciton: cystathionine gamma-lyase
	STACA0001_1480	mccA	cystathionine beta-synthase
	STACA0001_1481	mccB	cystathionine gamma-lyase
Position: -57 Score: 4.9 Sequence: TATATCCGATAGGAAAACTAAGTTTTA Locus tag: STACA0001_2088 Name: cysK Funciton: cysteine synthase
	STACA0001_2088	cysK	cysteine synthase
Position: -246 Score: 4.7 Sequence: TAAAGCATAGTATTCCGATAAGATATA Locus tag: STACA0001_1811 Name: cysJ Funciton: sulfite reductase [NADPH] flavoprotein, alpha-component Locus tag: STACA0001_1810 Name: cysI Funciton: sulfite reductase (NADPH) hemoprotein, beta-component Locus tag: STACA0001_1809 Name: cysG Funciton: uroporphyrin-III C-methyltransferase Locus tag: STACA0001_1808 Name: sirC Funciton: Precorrin-2 dehydrogenase Locus tag: STACA0001_1807 Name: ytnM Funciton: conserved membrane protein YtnM Locus tag: STACA0001_1806 Name: cysD Funciton: sulfate adenylyltransferase Locus tag: STACA0001_1805 Name: cysC Funciton: adenylylsulfate kinase
	STACA0001_1811	cysJ	sulfite reductase [NADPH] flavoprotein, alpha-component
	STACA0001_1810	cysI	sulfite reductase (NADPH) hemoprotein, beta-component
	STACA0001_1809	cysG	uroporphyrin-III C-methyltransferase
	STACA0001_1808	sirC	Precorrin-2 dehydrogenase
	STACA0001_1807	ytnM	conserved membrane protein YtnM
	STACA0001_1806	cysD	sulfate adenylyltransferase
	STACA0001_1805	cysC	adenylylsulfate kinase
Position: -71 Score: 5.5 Sequence: TTATTCTGACAATTCAGATAGGAATTT Locus tag: STACA0001_1812 Name: cysH Funciton: phosphoadenosine phosphosulfate reductase
	STACA0001_1812	cysH	phosphoadenosine phosphosulfate reductase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of CymR in Staphylococcus capitis SK14

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --