Regulon of ScrR in Bifidobacterium longum NCC2705

Properties
Regulator type:	Transcription factor
TF locus tag:	BL0546, BL0533
Regulator family:	LacI
Regulation mode:
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	ScrR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 23 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -99 Score: 5.9 Sequence: CTGTCGAACAGGTTCGAGAG Locus tag: BL0546 Name: scrR Funciton: Sucrose operon repressor, LacI family
	BL0546	scrR	Sucrose operon repressor, LacI family
Position: -170 Score: 5.7 Sequence: GCATCTAATCGGTTCGACAC Position: -105 Score: 6.9 Sequence: ATATCGAACCGGTTCGATAC Locus tag: BL0536 Name: scrP Funciton: Sucrose phosphorylase (EC 2.4.1.7) Locus tag: BL0534 Name: scrT1 Funciton: Sucrose permease, MFS family Locus tag: BL0533 Name: scrR Funciton: Sucrose operon repressor, LacI family
	BL0536	scrP	Sucrose phosphorylase (EC 2.4.1.7)
	BL0534	scrT1	Sucrose permease, MFS family
	BL0533	scrR	Sucrose operon repressor, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD