Regulon of BirA in Staphylococcus haemolyticus JCSC1435

Properties
Regulator type:	Transcription factor
TF locus tag:	SH1456
Regulator family:	BirA
Regulation mode:	repressor
Biological process:	Biotin biosynthesis
Effector:	Biotin
Regulog:	BirA - Staphylococcaceae
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - BirA
By TF family - BirA
By effector - Biotin
By pathway - Biotin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -55 Score: 7.6 Sequence: AATGTTAACATAATATAAAATAAAGTTAACATT Locus tag: SH2418 Name: yhfT Funciton: putative long chain fatty acid-CoA ligase Locus tag: SH2417 Name: yhfS Funciton: putative acetyl-CoA c-acetyltransferase Locus tag: SH2416 Name: SA0535 Funciton: hypothetical protein Locus tag: SH2415 Name: SA0536 Funciton: hypothetical protein
	SH2418	yhfT	putative long chain fatty acid-CoA ligase
	SH2417	yhfS	putative acetyl-CoA c-acetyltransferase
	SH2416	SA0535	hypothetical protein
	SH2415	SA0536	hypothetical protein
Position: -69 Score: 8.2 Sequence: AATGTAAACTTTTTATTTTATAAAGTTTACATT Locus tag: SH0770 Name: bioY Funciton: biotin transporter BioY Locus tag: SH0771 Name: SA2076 Funciton: putative acetyltransferase
	SH0770	bioY	biotin transporter BioY
	SH0771	SA2076	putative acetyltransferase
Position: -75 Score: 8 Sequence: AATGTAAACTTATTTATATATAAAGTTTACATT Locus tag: SH0269 Name: bioB Funciton: biotin synthase
	SH0269	bioB	biotin synthase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD