Regulon of FnrN in Rhodobacter sphaeroides 2.4.1

Properties
Regulator type:	Transcription factor
TF locus tag:	RSP_0698
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Regulog:	FnrN - Rhodobacterales
Statistics of regulated genes:
- Genes	20
- Operons	9
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 85 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By trascription factor - FnrN/FixK
By TF family - CRP
By effector - Oxygen
By pathway - Oxidative stress response
By pathway - Nitrogen fixation

Regulated operons
	Locus Tag	Name	Function
Position: -87 Score: 5.2 Sequence: GATTTGATCCTTATCAAGGC Locus tag: RSP_2984 Name: hemA Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
	RSP_2984	hemA	5-aminolevulinate synthase (EC 2.3.1.37)
Position: -111 Score: 5.4 Sequence: GCCTTGATCCATGTCAATGG Position: -79 Score: 5.1 Sequence: TACTTGATCCTCATCAAGGA Locus tag: RSP_0697 Name: uspA Funciton: Predicted universal stress protein UspA
	RSP_0697	uspA	Predicted universal stress protein UspA
Position: -136 Score: 5.1 Sequence: TCCTTGATGAGGATCAAGTA Position: -104 Score: 5.4 Sequence: CCATTGACATGGATCAAGGC Locus tag: RSP_0696 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: RSP_0695 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: RSP_0694 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: RSP_0693 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: RSP_0692 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: RSP_0691 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: RSP_0690 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: RSP_0689 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
	RSP_0696	ccoN	Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
	RSP_0695	ccoO	Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
	RSP_0694	ccoQ	Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
	RSP_0693	ccoP	Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
	RSP_0692	ccoG	Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
	RSP_0691	ccoH	Type cbb3 cytochrome oxidase biogenesis protein CcoH
	RSP_0690	ccoI	Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
	RSP_0689	ccoS	Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
Position: -31 Score: 5.5 Sequence: GCTTTGATTCAGATCAAGCG Locus tag: RSP_0698 Name: fnrN Funciton: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
	RSP_0698	fnrN	Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
Position: -81 Score: 5.2 Sequence: GAATTGATCTAAGTCAAAGG Locus tag: RSP_2395 Name: ccpR Funciton: Cytochrome c551 peroxidase (EC 1.11.1.5)
	RSP_2395	ccpR	Cytochrome c551 peroxidase (EC 1.11.1.5)
Position: -69 Score: 5.4 Sequence: CCATTGACGCAGATCAAGGC Locus tag: RSP_2507 Name: ompW Funciton: Outer membrane protein W precursor
	RSP_2507	ompW	Outer membrane protein W precursor
Position: -51 Score: 5.5 Sequence: CGCTTGATCTGAATCAAAGC Locus tag: RSP_0699 Name: hemN Funciton: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
	RSP_0699	hemN	Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
Position: -127 Score: 5.6 Sequence: TTATTGATCCAGATCAAAGT Locus tag: RSP_1877 Name: ctaD Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
	RSP_1877	ctaD	Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
Position: -161 Score: 5.5 Sequence: TCCTTGATTCAGATCAAATG Locus tag: RSP_1826 Name: ctaC Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) Locus tag: RSP_1827 Name: ctaB Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB Locus tag: RSP_6021 Name: ctaX Funciton: Hypothetical protein in cta gene cluster Locus tag: RSP_1828 Name: ctaG Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 Locus tag: RSP_1829 Name: ctaE Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
	RSP_1826	ctaC	Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
	RSP_1827	ctaB	Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
	RSP_6021	ctaX	Hypothetical protein in cta gene cluster
	RSP_1828	ctaG	Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
	RSP_1829	ctaE	Cytochrome c oxidase polypeptide III (EC 1.9.3.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of FnrN in Rhodobacter sphaeroides 2.4.1

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --