Regulon of FnrN in Sphingopyxis alaskensis RB2256

Properties
Regulator type:	Transcription factor
TF locus tag:	Sala_1678
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Regulog:	FnrN - Sphingomonadales
Statistics of regulated genes:
- Genes	11
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 23 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By trascription factor - FnrN/FixK
By TF family - CRP
By effector - Oxygen
By pathway - Oxidative stress response
By pathway - Nitrogen fixation

Regulated operons
	Locus Tag	Name	Function
Position: -97 Score: 5.3 Sequence: ACATTGACCGGGATCAACGA Position: -75 Score: 4.6 Sequence: TGCTTGCGCTCCATCAATGC Locus tag: Sala_1677 Name: ompW Funciton: Outer membrane protein W precursor
	Sala_1677	ompW	Outer membrane protein W precursor
Position: -51 Score: 4.8 Sequence: CCGTTGATGCCGATCAATGC Locus tag: Sala_1668 Name: hemN Funciton: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
	Sala_1668	hemN	Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
Position: -69 Score: 4.8 Sequence: GATTTGATGCGAATCAATGA Locus tag: Sala_1679 Name: uspA Funciton: Predicted universal stress protein UspA
	Sala_1679	uspA	Predicted universal stress protein UspA
Position: -112 Score: 4.6 Sequence: GCATTGATGGAGCGCAAGCA Position: -90 Score: 5.3 Sequence: TCGTTGATCCCGGTCAATGT Locus tag: Sala_1676 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: Sala_1675 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: Sala_1674 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: Sala_1673 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: Sala_1672 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: Sala_1671 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: Sala_1670 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Sala_1669 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
	Sala_1676	ccoN	Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
	Sala_1675	ccoO	Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
	Sala_1674	ccoQ	Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
	Sala_1673	ccoP	Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
	Sala_1672	ccoG	Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
	Sala_1671	ccoH	Type cbb3 cytochrome oxidase biogenesis protein CcoH
	Sala_1670	ccoI	Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
	Sala_1669	ccoS	Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD