Regulon of PhsR in Vibrio fischeri ES114

Properties
Regulator type:	Transcription factor
TF locus tag:	VF_A0103
Regulator family:	LuxR
Regulation mode:	activator
Biological process:	Thiosulfate reduction
Effector:	Thiosulfate
Regulog:	PhsR - Vibrionales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - PhsR
By TF family - LuxR
By effector - Thiosulfate
By pathway - Thiosulfate reduction

Regulated operons
	Locus Tag	Name	Function
Position: -224 Score: 7.5 Sequence: ATTATTGTGGTTTACCACAATAGT Locus tag: VF_A0101 Name: sirA Funciton: Predicted sulfide reductase, catalytic and NADH- and FAD-binding subunit Locus tag: VF_A0100 Name: sirC Funciton: Predicted sulfide reductase, anchor subunit Locus tag: VF_A0099 Name: sirB Funciton: Predicted sulfide reductase, FeS cluster subunit Locus tag: VF_A0098 Name: yceA Funciton: Predicted thiosulfate sulfurtransferase
	VF_A0101	sirA	Predicted sulfide reductase, catalytic and NADH- and FAD-binding subunit
	VF_A0100	sirC	Predicted sulfide reductase, anchor subunit
	VF_A0099	sirB	Predicted sulfide reductase, FeS cluster subunit
	VF_A0098	yceA	Predicted thiosulfate sulfurtransferase
Position: -212 Score: 7.5 Sequence: ACTATTGTGGTAAACCACAATAAT Locus tag: VF_A0102 Name: phsS Funciton: Thiosulfate reduction sensor protein PhsS Locus tag: VF_A0103 Name: phsR Funciton: Thiosulfate reduction response regulator protein PhsR, LuxR family
	VF_A0102	phsS	Thiosulfate reduction sensor protein PhsS
	VF_A0103	phsR	Thiosulfate reduction response regulator protein PhsR, LuxR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD