Regulon of IdeR in Dorea longicatena DSM 13814

Properties
Regulator type:	Transcription factor
TF locus tag:	DORLON_00345
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	IdeR - Clostridia-3
Statistics of regulated genes:
- Genes	12
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 78 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - DtxR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -120 Score: 6.7 Sequence: AACGTTAGCATATACTAACTAT Locus tag: DORLON_00346 Name: null Funciton: hypothetical protein Locus tag: DORLON_00347 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: DORLON_00348 Name: feoB Funciton: Ferrous iron transport protein B Locus tag: DORLON_00349 Name: null Funciton: hypothetical protein Locus tag: DORLON_00350 Name: null Funciton: hypothetical protein Locus tag: DORLON_00351 Name: null Funciton: hypothetical protein Locus tag: DORLON_00352 Name: null Funciton: hypothetical protein Locus tag: DORLON_00353 Name: null Funciton: hypothetical protein Locus tag: DORLON_00354 Name: COG2217 Funciton: Cation transporting ATPase
	DORLON_00346		hypothetical protein
	DORLON_00347	feoA	Ferrous iron transport protein A
	DORLON_00348	feoB	Ferrous iron transport protein B
	DORLON_00349		hypothetical protein
	DORLON_00350		hypothetical protein
	DORLON_00351		hypothetical protein
	DORLON_00352		hypothetical protein
	DORLON_00353		hypothetical protein
	DORLON_00354	COG2217	Cation transporting ATPase
Position: -156 Score: 6.3 Sequence: ATAGTTAGTATATGCTAACGTT Locus tag: DORLON_00345 Name: ideR Funciton: Predicted iron-dependent repressor, DtxR family
	DORLON_00345	ideR	Predicted iron-dependent repressor, DtxR family
Position: -108 Score: 4.4 Sequence: AAAGATATGATATGCTGACGAT Position: -88 Score: 6.4 Sequence: ATAGTTAGAATAATCTAACTAT Locus tag: DORLON_00359 Name: eno Funciton: Enolase (EC 4.2.1.11)
	DORLON_00359	eno	Enolase (EC 4.2.1.11)
Position: -48 Score: 4.9 Sequence: TTAGTTAGATAAAGCTAACTAA Locus tag: DORLON_00403 Name: PF10087 Funciton: Uncharacterized protein conserved in bacteria
	DORLON_00403	PF10087	Uncharacterized protein conserved in bacteria

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD