Regulon of PaaR in Streptomyces scabiei 87.22

Properties
Regulator type:	Transcription factor
TF locus tag:	SCAB_45331
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Streptomycetaceae
Statistics of regulated genes:
- Genes	12
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -74 Score: 5.8 Sequence: AGTAACCGAACGATCGGTCGGG Locus tag: SCAB_45341 Name: paaH Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) Locus tag: SCAB_45331 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	SCAB_45341	paaH	3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
	SCAB_45331	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family
Position: -155 Score: 5.8 Sequence: CCCGACCGATCGTTCGGTTACT Locus tag: SCAB_45351 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	SCAB_45351	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
Position: -184 Score: 5.2 Sequence: CCCAACCGACCATTCGTTCGGG Position: -52 Score: 5.5 Sequence: AGCAACCGAATGGTCGGTCGGC Locus tag: SCAB_82261 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	SCAB_82261	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Position: -77 Score: 5.9 Sequence: AACGACCGAACAATCGGTAGGT Locus tag: SCAB_45311 Name: bkdA Funciton: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4) Locus tag: SCAB_45301 Name: bkdB Funciton: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4) Locus tag: SCAB_45291 Name: bkdC Funciton: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
	SCAB_45311	bkdA	Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
	SCAB_45301	bkdB	Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
	SCAB_45291	bkdC	Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
Position: -166 Score: 5.5 Sequence: GCCGACCGACCATTCGGTTGCT Position: -34 Score: 5.2 Sequence: CCCGAACGAATGGTCGGTTGGG Locus tag: SCAB_82281 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: SCAB_82291 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: SCAB_82301 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: SCAB_82311 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: SCAB_82321 Name: paaE Funciton: Phenylacetate-CoA oxygenase, PaaE subunit
	SCAB_82281	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	SCAB_82291	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	SCAB_82301	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	SCAB_82311	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	SCAB_82321	paaE	Phenylacetate-CoA oxygenase, PaaE subunit

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD