Regulon of MntR in Listeria seeligeri serovar 1/2b str. SLCC3954

Properties
Regulator type:	Transcription factor
TF locus tag:	lse_1861
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Listeriaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -51 Score: 6.4 Sequence: AATGTTTCCCGTAGTAAACTTT Locus tag: lse_1343 Name: mntH Funciton: Manganese transport protein MntH
	lse_1343	mntH	Manganese transport protein MntH
Position: -69 Score: 6.4 Sequence: AAAGTTGCTCTAAGGAAACATT Locus tag: lse_1829 Name: mntB Funciton: Manganese ABC transporter, inner membrane permease protein Locus tag: lse_1828 Name: mntC Funciton: Manganese ABC transporter, inner membrane permease protein Locus tag: lse_1827 Name: mntA Funciton: Manganese ABC transporter, inner membrane permease protein
	lse_1829	mntB	Manganese ABC transporter, inner membrane permease protein
	lse_1828	mntC	Manganese ABC transporter, inner membrane permease protein
	lse_1827	mntA	Manganese ABC transporter, inner membrane permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD