Regulon of NsrR in Shewanella sediminis HAW-EB3

Properties
Regulator type:	Transcription factor
TF locus tag:	Ssed_4474
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	NsrR - Shewanellaceae
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 51 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - NsrR
By TF family - Rrf2
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -169 Score: 5 Sequence: ACATGCAAAATCAATACAGGT Locus tag: Ssed_4366 Name: Ssed_4366 Funciton: hydroxylamine oxidoreductase Locus tag: Ssed_4367 Name: Ssed_4367 Funciton: NapC/NirT cytochrome c domain protein
	Ssed_4366	Ssed_4366	hydroxylamine oxidoreductase
	Ssed_4367	Ssed_4367	NapC/NirT cytochrome c domain protein
Position: -13 Score: 4.5 Sequence: ACTTGCATCTTAAATGCACCT Locus tag: Ssed_2876 Name: nnrS Funciton: NnrS protein involved in response to NO
	Ssed_2876	nnrS	NnrS protein involved in response to NO
Position: -42 Score: 5.4 Sequence: ACATGCAAATAAAAAGCATGA Locus tag: Ssed_1165 Name: hcp Funciton: Hydroxylamine reductase (EC 1.7.-.-) Locus tag: Ssed_1166 Name: hcr Funciton: NADH oxidoreductase hcr (EC 1.-.-.-)
	Ssed_1165	hcp	Hydroxylamine reductase (EC 1.7.-.-)
	Ssed_1166	hcr	NADH oxidoreductase hcr (EC 1.-.-.-)
Position: -32 Score: 4.8 Sequence: AGATATAAATAATTTGCAGCT Locus tag: Ssed_4124 Name: dnrN Funciton: Nitric oxide-dependent regulator DnrN or NorA
	Ssed_4124	dnrN	Nitric oxide-dependent regulator DnrN or NorA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD